ID: 995650388

View in Genome Browser
Species Human (GRCh38)
Location 5:114362289-114362311
Sequence GCTGCTGGTGCGCGAGGTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995650388_995650393 -10 Left 995650388 5:114362289-114362311 CCCGCACCTCGCGCACCAGCAGC 0: 1
1: 0
2: 2
3: 29
4: 277
Right 995650393 5:114362302-114362324 CACCAGCAGCCGGCCAGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 158
995650388_995650397 9 Left 995650388 5:114362289-114362311 CCCGCACCTCGCGCACCAGCAGC 0: 1
1: 0
2: 2
3: 29
4: 277
Right 995650397 5:114362321-114362343 GCGGCAGCAGCCCATGCCTCCGG 0: 1
1: 0
2: 1
3: 25
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995650388 Original CRISPR GCTGCTGGTGCGCGAGGTGC GGG (reversed) Exonic
900364776 1:2306642-2306664 GCTGCGGGAGCGCGAGGCCCGGG + Exonic
900647861 1:3717188-3717210 GCTGCCGGGGAGCGAGGAGCGGG + Intronic
900982087 1:6051638-6051660 GCAGCGGCTGCGGGAGGTGCGGG + Exonic
901109630 1:6784913-6784935 GCTGCTGGCGCGTGGGGTCCCGG - Intergenic
901493332 1:9607671-9607693 GCTGCTGGTTGGCGAGGGGCAGG - Exonic
902108849 1:14060971-14060993 GCTGCTGGTGTGGGAGGAGAAGG - Intergenic
902950997 1:19882705-19882727 GCTGAAGCTGCGGGAGGTGCCGG + Exonic
903342214 1:22661562-22661584 ACTTCTGGTGTGCCAGGTGCTGG - Intergenic
903759150 1:25685568-25685590 GCAGCTGGGGAGCAAGGTGCTGG + Intronic
903788325 1:25875656-25875678 GCTGCTTGTGCGCGGCGGGCGGG - Intergenic
904082666 1:27882062-27882084 GCTGCTGCTGAGCGAGGTCCTGG + Exonic
905183108 1:36178546-36178568 GCAGCGGGAGCGCGAGGAGCAGG + Exonic
912363472 1:109113869-109113891 GCCGCTGGTGCGCGCGGCGTGGG - Intronic
912758247 1:112342712-112342734 GCTGCTGGTGCTCCAGCTGTCGG + Intergenic
914950749 1:152111299-152111321 GCTGCTGAAGAGCGAGGAGCAGG - Exonic
914950755 1:152111341-152111363 GCGGCTGAAGCGCGAGGAGCCGG - Exonic
915345619 1:155195438-155195460 GATGCGGGTGGGGGAGGTGCTGG - Intergenic
916749988 1:167714753-167714775 GCTTCGGGTGCGAGAGGTCCCGG + Intergenic
919924340 1:202184758-202184780 GCGGCTGGTGCGGGAGTAGCAGG + Intergenic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
1062836106 10:636889-636911 GCTGCTGGTTCACGAGGGGCGGG + Intronic
1064208037 10:13341447-13341469 GCTGCTGGCGGGGGCGGTGCAGG - Intronic
1065854284 10:29816979-29817001 GATGCTGGGGCGCAGGGTGCTGG + Intergenic
1067046064 10:42985860-42985882 ACTGCTGGTGCGTGGGGTGAAGG + Intergenic
1068849278 10:61718020-61718042 GATGCTGGTCCGCGTGGTTCAGG + Intronic
1069774910 10:70920689-70920711 GCAGGTGGTGGGGGAGGTGCTGG - Intergenic
1070948101 10:80409292-80409314 GTTGCTGGAGCGGGAGGTGAAGG + Intronic
1072188461 10:93062799-93062821 GCTCCTGGTGCGCGGCGGGCGGG + Exonic
1072938146 10:99732717-99732739 GCTGCTGGTGCGGGCGGTACTGG - Intronic
1073403570 10:103277703-103277725 CCTGCTGGAGCGCGACGGGCTGG + Exonic
1074618303 10:115092934-115092956 GCTCCCGGGGCGCGGGGTGCGGG + Intergenic
1075032135 10:119030416-119030438 GCTGCTGAAGCCCGAGCTGCAGG + Exonic
1075147341 10:119893222-119893244 GTTGTTGGTACGCCAGGTGCTGG + Intronic
1076234312 10:128851953-128851975 GCTGCTGGGATGCGAGGTACAGG - Intergenic
1076722115 10:132397250-132397272 GCTGCCGGTGCGGGTGGAGCAGG + Exonic
1076823835 10:132957421-132957443 GCTGTTAGTGCTCCAGGTGCGGG - Intergenic
1076858587 10:133129171-133129193 GCTGTCTGTGCGCGAGCTGCGGG - Exonic
1077426623 11:2482805-2482827 GCTGCAGGTGCACCAGGGGCAGG - Intronic
1078433211 11:11303303-11303325 GCTGCTGGTGCCAGTGCTGCTGG - Intronic
1078806562 11:14711573-14711595 GAGTCTGGTGCGGGAGGTGCCGG + Intronic
1079184889 11:18227818-18227840 GGTGCTGGTGCCAGAGGAGCAGG + Intronic
1079242377 11:18729710-18729732 GCACCTGGTGCGGGAGGTGGAGG - Exonic
1083593137 11:63906830-63906852 GCTGCTGGTGGCAGGGGTGCTGG - Intronic
1083812319 11:65112696-65112718 ACTGCCGGCGCGCAAGGTGCGGG + Exonic
1083890125 11:65591833-65591855 GCTGCTGAGCCGCGAGCTGCGGG + Exonic
1084219255 11:67667490-67667512 GCAGCTTCTGCGCGACGTGCTGG - Exonic
1084935818 11:72586112-72586134 GGTGCTGGTGAGCACGGTGCTGG + Exonic
1087806273 11:102558747-102558769 GATGCTGGTGCCCAAGGTGGAGG + Intergenic
1094142759 12:27198093-27198115 GCTGCTGTTGAGCTAGGGGCTGG - Intergenic
1094494562 12:30981257-30981279 GCTGCTGGAGGGCCGGGTGCTGG - Intronic
1096018105 12:48296785-48296807 ACGGCTGGTGCGCTCGGTGCAGG + Intergenic
1096121110 12:49090029-49090051 GCTGCTGGTGAACGATGTCCTGG - Exonic
1096495495 12:52037264-52037286 GCTGCAGGAGCGCGAGGAGGAGG + Intronic
1097383230 12:58920172-58920194 GCTGCTGCTGTGCGCGGTGCTGG - Exonic
1098925754 12:76348295-76348317 GTTGCAGGTGGCCGAGGTGCTGG - Exonic
1104021252 12:124993853-124993875 GCTGCTGCTGCTCGGGCTGCTGG + Exonic
1104983279 12:132583259-132583281 GCTGCAGGGGCGCGGGGTGCAGG - Exonic
1105927328 13:25019237-25019259 GCTGCTGGTGCCTGACGTGCAGG + Intergenic
1107910489 13:45101017-45101039 GCTGCTGGCATGCGAGGAGCTGG + Intergenic
1113417335 13:110138481-110138503 CCTGCAGGTGCGCGCGGGGCAGG + Intergenic
1113768376 13:112894425-112894447 GCGGCAGGTGCGCGCGGGGCGGG + Intronic
1113817103 13:113180008-113180030 GCTGCTGCTGCACGAGGCGCTGG - Exonic
1114454417 14:22845928-22845950 GCTGCTGCTGCTCCTGGTGCTGG + Exonic
1114670469 14:24408231-24408253 GCTGCTGCTGAGCCTGGTGCGGG + Exonic
1115713201 14:36073083-36073105 GCTGCTGGTGTGCGGCCTGCTGG + Intergenic
1117092851 14:52267931-52267953 GCTGCTGGCGCGCTCGGGGCTGG + Exonic
1117690235 14:58298758-58298780 GCTGCTGCTGCCCGAGGTCCCGG + Intronic
1118071332 14:62249616-62249638 GCTGCTGCTGGGGGAGGTGTGGG - Intergenic
1118849343 14:69572476-69572498 GCGGCGGGAGCGCGAGGAGCGGG - Exonic
1122789771 14:104179283-104179305 GCAGCGGCTGCGGGAGGTGCAGG + Exonic
1122866158 14:104604909-104604931 GCTCCTGGTGCGCGCGGGCCAGG + Exonic
1122975264 14:105168354-105168376 GCTGCTGGCGCTCTGGGTGCAGG - Exonic
1123716790 15:23039483-23039505 GCAGCAGGAGCGCGACGTGCGGG - Exonic
1125506323 15:40269806-40269828 GCTGCTGCTGCTGCAGGTGCTGG - Intronic
1125513915 15:40307545-40307567 GCTGCTGGAGCACCAGGTGGTGG - Intronic
1127142664 15:55993504-55993526 GCTCCTGGAGGACGAGGTGCGGG - Intronic
1128113876 15:65093541-65093563 GCTGTTTGTGCTCCAGGTGCAGG - Intronic
1128614948 15:69101621-69101643 ACTGCTGATGCGTGAGGGGCTGG + Intergenic
1129273898 15:74433308-74433330 TCTGCTGGCGCGCGGGGCGCAGG - Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130224230 15:82045585-82045607 GCTGGTCGAGCGCGAGCTGCAGG + Exonic
1130270829 15:82445978-82446000 GCGACTGGGGCGAGAGGTGCCGG - Intergenic
1130463169 15:84173301-84173323 GCGACTGGGGCGAGAGGTGCCGG - Intronic
1130489505 15:84421487-84421509 GCGACTGGGGCGAGAGGTGCCGG + Intergenic
1130501096 15:84500249-84500271 GCGACTGGGGCGAGAGGTGCCGG + Intergenic
1132117872 15:99150841-99150863 GTTGCTGGTGGGAGAGGTGCAGG - Intronic
1132365176 15:101251715-101251737 GCGGCTCGGGCGCGAGGTGGCGG + Exonic
1132902186 16:2263167-2263189 GCTGGAGCTGCGGGAGGTGCTGG + Exonic
1133060615 16:3172076-3172098 GCTTCGGGTGCGAGAGGTCCCGG + Intergenic
1133118011 16:3589279-3589301 GCTGCTGGTGCTCAGGGGGCCGG + Exonic
1133203445 16:4218633-4218655 GCTGCTGGTGATGGAGGAGCAGG - Intronic
1136349324 16:29696872-29696894 GCAGCTGGGGCGCGGGGAGCCGG - Intronic
1136512789 16:30749099-30749121 GCTGCTGCTGCTGGTGGTGCTGG + Intronic
1136512818 16:30749239-30749261 GGTGCTGGTGCTGGTGGTGCTGG + Intronic
1137247963 16:46720826-46720848 GGGGCTGCTGAGCGAGGTGCTGG - Intronic
1137501225 16:49013180-49013202 CCTGCTGGTGCTTGAGGTGAGGG - Intergenic
1137712246 16:50574504-50574526 GCTGCTGGTGGCCGAGGCCCAGG + Intronic
1141132502 16:81445304-81445326 GCTGCTGGGGGGCGACGTGTCGG + Exonic
1141677741 16:85526421-85526443 GCTGCTGGCGCGCGTGGGACTGG - Intergenic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1142227702 16:88885587-88885609 GCTGCTGCTGCCCAAGGGGCAGG - Intronic
1142473466 17:176383-176405 GGTGTTGGTGCGGGGGGTGCGGG + Intronic
1143562681 17:7705049-7705071 GCGGGAGGTGCGCGAGGTGAGGG + Intergenic
1143644700 17:8222854-8222876 GCTTCGGGTGCGAGAGGTCCCGG - Intergenic
1144608429 17:16688210-16688232 GCTGCTCTTGCGGGTGGTGCTGG + Intergenic
1145128193 17:20319143-20319165 GCTGCTCTTGCGGGTGGTGCTGG + Intergenic
1145196413 17:20898062-20898084 GCTGCTCTTGCGGGTGGTGCTGG - Intergenic
1146054041 17:29572493-29572515 GGCGCTGCTGCGCGAGGGGCCGG - Exonic
1147686310 17:42288659-42288681 GCTCCGGGTGCCGGAGGTGCCGG - Intronic
1147951592 17:44110855-44110877 GCTGCTGGTGCCCAAGGCTCAGG - Intronic
1148739981 17:49887311-49887333 GCTGCTGGTGGGGGGTGTGCAGG + Intergenic
1151453706 17:74214064-74214086 AATCCTGGCGCGCGAGGTGCGGG + Intronic
1151565129 17:74893442-74893464 GCTGCGGGAGCTGGAGGTGCTGG - Exonic
1151585802 17:75007765-75007787 GCTGCTGGTGCGAGAAGGGGTGG - Intergenic
1151625282 17:75272084-75272106 GCTGCTGGTTCCCAAGGTCCAGG - Intergenic
1152662733 17:81550476-81550498 GAAGCTGGTGCCCGAGCTGCGGG - Exonic
1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG + Intergenic
1154501125 18:14998557-14998579 CCTGCTGGGGCGTGAGGTGCGGG - Intergenic
1155221440 18:23689595-23689617 GCTGCAGGTCCGGGAGGCGCAGG + Exonic
1156462973 18:37332009-37332031 GCTGCACGTGCAGGAGGTGCAGG + Intronic
1157222735 18:45839046-45839068 GCTGCTGCTGCTCGGGGTCCTGG + Exonic
1157605717 18:48924713-48924735 GCTGCTGGTGGGGGAGCTGGAGG - Intronic
1158389649 18:57034624-57034646 GCTGATGGAGGGCGATGTGCTGG + Exonic
1160551310 18:79695337-79695359 CCTGCTGGGGCTCGAGGTGGTGG + Intronic
1160583194 18:79899249-79899271 GCTCCTGGAGCGCGCGGGGCTGG + Exonic
1160780922 19:877716-877738 GCTGCTGGGGCACGTGGGGCAGG - Intronic
1160780948 19:877790-877812 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160780980 19:877902-877924 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781002 19:877970-877992 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781020 19:878032-878054 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781060 19:878182-878204 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781085 19:878250-878272 GCTGCTGGGGCCCGTGGGGCTGG - Intronic
1160781102 19:878306-878328 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781124 19:878374-878396 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781151 19:878448-878470 GCTGCTGGGGCACGTGGGGCCGG - Intronic
1160781168 19:878504-878526 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781204 19:878628-878650 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781238 19:878740-878762 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781257 19:878796-878818 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781282 19:878864-878886 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781353 19:879074-879096 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781378 19:879142-879164 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781419 19:879318-879340 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781450 19:879430-879452 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781467 19:879486-879508 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781503 19:879622-879644 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781519 19:879678-879700 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781543 19:879766-879788 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781561 19:879822-879844 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781586 19:879910-879932 GCTGCTGGGGCACGTGGGGCCGG - Intronic
1161314872 19:3613070-3613092 GCTGCTGGCGCGAGAGCTGCAGG + Exonic
1161483738 19:4523818-4523840 GCTGCTGGAGCTGGTGGTGCAGG - Exonic
1162019485 19:7862166-7862188 GCTGGTCGTGGGCGAGCTGCAGG + Exonic
1162100365 19:8335256-8335278 GCAGCTGGTGCGCGAGCAGATGG - Exonic
1162133867 19:8543725-8543747 GCTGGTGGTGCTGGTGGTGCTGG + Intronic
1162133878 19:8543767-8543789 GCTGGTGGTGCTGGTGGTGCTGG + Intronic
1162133903 19:8543857-8543879 GCTGGTGGTGCTGGTGGTGCTGG + Intronic
1162343782 19:10107999-10108021 GCTGCTCGTGCATGCGGTGCCGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162794100 19:13077896-13077918 GCTTCTGGTGCCAGAGGTGTGGG - Intronic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166334340 19:42096195-42096217 GCTGCGGGTGCGAGAGGTGCGGG + Exonic
1166385023 19:42375995-42376017 GCTGGTGGTCCGCGGCGTGCGGG + Exonic
1166762658 19:45234611-45234633 GGCGCTGGTGCGCGAGACGCTGG - Intronic
1166862174 19:45816875-45816897 GCTGCTGGGGCGGCAGCTGCAGG + Exonic
1167350168 19:48969387-48969409 GCCGCTGGTGGAGGAGGTGCAGG + Exonic
1168293904 19:55369732-55369754 GCTGGGGGTGTGCGAGGCGCGGG - Intronic
1168354846 19:55694736-55694758 GCTGCTGGCAGGAGAGGTGCCGG + Exonic
927672649 2:25082063-25082085 GCTGCTGGTGGCCCAGGTGAGGG + Intronic
928331280 2:30359881-30359903 GAAGCTGGTGCCCGTGGTGCAGG + Intergenic
929604368 2:43225389-43225411 GCTGCAGGTGCAGGAGGTGCTGG + Exonic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
932774092 2:74516655-74516677 GGTGCTGGAGCGCGAGAGGCTGG + Exonic
934113578 2:88764643-88764665 GCTGCTGGTGCCTGACGTGCAGG - Intergenic
934557800 2:95296667-95296689 GGTGCTGGTCTGCAAGGTGCTGG - Intergenic
934723856 2:96602273-96602295 GGTGCTGGTGCCCGTGGTGATGG + Exonic
934730073 2:96650798-96650820 CCAGCTGCTGCGCGAGGAGCAGG - Intergenic
934754640 2:96816625-96816647 GCTGGCGGTGCGCGTGGAGCCGG + Exonic
938960509 2:136336342-136336364 GCTGCTGCTGCAAGAGGCGCTGG - Intergenic
940769987 2:157829373-157829395 ACTGCTGGTGGGAGAGGTCCTGG - Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
947124347 2:226851608-226851630 GGTAGTGGTGAGCGAGGTGCAGG - Intronic
947549731 2:231037664-231037686 GCTGCTGGTGGGCGAGCTGTGGG + Exonic
948350977 2:237340671-237340693 GATGCTGACGGGCGAGGTGCCGG - Exonic
948461339 2:238131306-238131328 GCTGCTGGAGTGCGACCTGCCGG + Exonic
948514346 2:238494328-238494350 CGTGCAGGTGGGCGAGGTGCAGG + Intergenic
1171169347 20:23001488-23001510 ACTGCAGGTGCGTGGGGTGCTGG - Intergenic
1172155387 20:32820255-32820277 GCTGCTGCTACGCGGGGTGGGGG + Intronic
1172702743 20:36863091-36863113 GCTCCCGGGGCGCGCGGTGCGGG - Exonic
1172957565 20:38771781-38771803 GCTGCTGGTGGAGGTGGTGCTGG + Exonic
1174503889 20:51004542-51004564 GCTGGTGCTGCGCGTGCTGCGGG - Exonic
1175443735 20:59007062-59007084 GCTGCTGGCGGGCGCGGCGCAGG - Exonic
1175892005 20:62319823-62319845 GCTGCTGGTAGGCGAGGGTCGGG + Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176029816 20:63006548-63006570 TGAGCTGGGGCGCGAGGTGCAGG + Exonic
1176111728 20:63413998-63414020 GCTGCCGGTGCTCATGGTGCTGG - Intronic
1176170237 20:63693427-63693449 GCTGCTGGTGCTGGTGGTGGAGG - Intronic
1176171529 20:63698473-63698495 GCTGCTGGTGCGGCTGCTGCAGG + Exonic
1178763672 21:35428815-35428837 GCTGCTTGTGGGCCAGGTGATGG + Intronic
1179412877 21:41175617-41175639 GCTGCTGGTGGGGGTGCTGCTGG - Intronic
1179435673 21:41360570-41360592 GCTGCTGGTGAGGGGCGTGCAGG + Intergenic
1179890181 21:44331299-44331321 GCTGCTGGTGCCTGTGGTGGGGG - Intronic
1180736995 22:18024541-18024563 GCTGCAGGAGCGCGCGCTGCTGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181572114 22:23773241-23773263 GCGGCTGGAGCGCGAGAGGCAGG - Intronic
1181813688 22:25421086-25421108 GCTGCTGGGGCGCGCAGAGCGGG + Intergenic
1182032038 22:27167027-27167049 GCTGATGGTGCGGGAGGTAAAGG - Intergenic
1182212661 22:28689781-28689803 GCTGCAGGAGCGGGAGGTGAGGG + Intronic
1182299481 22:29329720-29329742 CCTGCTGGTTCCCGTGGTGCAGG - Exonic
1183003788 22:34883358-34883380 GCTGCTGGTTGGCATGGTGCAGG - Intergenic
1183850888 22:40586896-40586918 GCTGCTGGTGCTGCTGGTGCTGG + Intronic
1184750232 22:46481703-46481725 GCTGCGGGTGCAGGAGGTGGTGG - Intronic
1185420402 22:50731536-50731558 GAGGCTGGGGCGGGAGGTGCCGG + Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950207467 3:11091986-11092008 GGTGGTGGTGGGCGAGGTGCAGG - Intergenic
950304241 3:11906015-11906037 GCTGCTGGTGCTCTGGGTGAAGG - Intergenic
950304601 3:11908232-11908254 GCTGCTGGTGCTCAGGGTGGAGG - Intergenic
950304633 3:11908390-11908412 GCTGCTGGTGCTCTGGGTGAAGG - Intergenic
951823144 3:26836544-26836566 GGTGCTGGTGGTGGAGGTGCTGG + Intergenic
954618077 3:51980448-51980470 GCTGCTGGAGCGGGCGCTGCGGG + Exonic
956892256 3:73624444-73624466 GCTGCTGCGGCGCGACGTGGAGG - Exonic
957048961 3:75396897-75396919 GCTGCTGGTGCCTGATGTGCAGG + Intergenic
961539737 3:127591207-127591229 GCGGCTGGAGCGCGTGGCGCCGG - Intronic
965820220 3:172677632-172677654 GCTGTTGGTGGGGGAGGGGCGGG + Intronic
966230147 3:177642603-177642625 GCTGCTGCTGTGCTGGGTGCTGG + Intergenic
968098903 3:195952413-195952435 GCTGTGGGTGGGGGAGGTGCTGG - Intergenic
968306109 3:197652711-197652733 GCTGTGGGTGGGGGAGGTGCTGG - Intergenic
968431121 4:559757-559779 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431125 4:559772-559794 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431139 4:559832-559854 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431146 4:559862-559884 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431153 4:559892-559914 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431174 4:559982-560004 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968434066 4:576081-576103 GCGGCGGGCGCGCGGGGTGCGGG - Intergenic
968602564 4:1517262-1517284 GCTGCTGGTGGGCGGAGGGCTGG - Intergenic
969867421 4:10084864-10084886 GGTGCTGGTCGGCGGGGTGCAGG - Intronic
970001795 4:11372300-11372322 GCTGGAGCTGCGGGAGGTGCTGG - Intergenic
971457911 4:26861218-26861240 GTTGCTGGTGCTCGGGCTGCTGG + Exonic
972960563 4:44447974-44447996 GCTGCTGCTGCGCGGGGCGGCGG - Exonic
973605100 4:52579065-52579087 GCTGCTGGTGCTGCTGGTGCTGG + Intergenic
975620465 4:76291299-76291321 GCTGCTGCTGGGTAAGGTGCTGG - Intronic
984955085 4:185037087-185037109 CCTGCTGGTGAGCGTGGTGAGGG - Intergenic
985713237 5:1442033-1442055 GCTGGGGGTGGGGGAGGTGCAGG - Intronic
985896397 5:2751929-2751951 GCTGCAGGTCCGCGAGCCGCGGG - Intergenic
986335147 5:6749134-6749156 GCTGCAGGTGCTGGTGGTGCTGG + Intronic
986624033 5:9706788-9706810 GCTGCTGGGGAGGGAGCTGCAGG + Intronic
986864780 5:11973486-11973508 GCTGCTGATGAGAGAGCTGCTGG - Intergenic
988264296 5:28928784-28928806 GCTGCTGGTGCCTGACGTGCAGG + Intergenic
989207377 5:38824482-38824504 GGTGCTGGTGCTGGTGGTGCTGG - Intergenic
989780687 5:45262000-45262022 GCTGCTGGTGGAGGGGGTGCTGG + Exonic
990493686 5:56326013-56326035 GCTGCTGGTGAGGGTGGTGGTGG - Intergenic
992690701 5:79237361-79237383 GCTGCTGGTGCACGGCGCGCAGG - Exonic
993632099 5:90299074-90299096 GCTGCTGGTGAGAGAGGTAGGGG + Intergenic
993872375 5:93267861-93267883 GCTGCTGGTGGGCGTGGTGACGG + Intergenic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
995650484 5:114362703-114362725 GCTGGTGGTGCGCCGGGTGCGGG - Exonic
997709303 5:135990530-135990552 GCTGAGGGTGCTGGAGGTGCTGG + Intergenic
997709305 5:135990539-135990561 GCTGGAGGTGCTGGAGGTGCTGG + Intergenic
998137328 5:139681033-139681055 GATGCTGAAGCGCGTGGTGCAGG + Exonic
1001482231 5:172096346-172096368 CCTGCTGGTGTGGGAGGGGCAGG - Intronic
1002338246 5:178495187-178495209 GCTGCTGATGGGCGGGGTGCAGG - Intronic
1002348210 5:178562728-178562750 GCTGGTGGTGGGGGGGGTGCGGG + Intronic
1003083866 6:3045401-3045423 GCTGCGGGTGCAGGAGGTGGTGG + Intergenic
1003318891 6:5035488-5035510 GCAGCTGGTGGGGGAGGTGGAGG - Intergenic
1004179098 6:13365468-13365490 GCCGCTGGTGTGTGAGGTGCAGG - Exonic
1007275577 6:40671126-40671148 GCTGCTGATGAGAGAGCTGCTGG - Intergenic
1011603512 6:89081102-89081124 GCTGCTGGAGCGCGAGGCTGGGG - Exonic
1011669675 6:89671038-89671060 CTTGCTGGTGCGCCTGGTGCCGG - Exonic
1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG + Intronic
1014079503 6:117270745-117270767 GATGCGGGTGCGCGTGGTGCGGG - Exonic
1019216516 6:170447360-170447382 GCTGCTGGTGCGGGCCCTGCCGG + Intergenic
1019217283 6:170452123-170452145 GTGGCTGGTGCGGGAGGGGCCGG - Intergenic
1020097259 7:5376135-5376157 GCAGCTGCTGGGCGTGGTGCAGG + Exonic
1022094551 7:27130562-27130584 GCTGCTGCAGCGGCAGGTGCTGG + Exonic
1022207784 7:28180294-28180316 GATGCGGGGGCGCGAGGTGCCGG - Intronic
1025020790 7:55477530-55477552 GCTGCAGGTGAGGGAGGGGCGGG + Intronic
1026981062 7:74526782-74526804 GCTGCTGATGTGGGAGGTGGGGG + Intronic
1030216015 7:107044652-107044674 GCGGCTGGAGCGGGAGGAGCAGG + Exonic
1033727642 7:144136374-144136396 GGTGATGGTGCGAGAGATGCTGG - Intergenic
1034200777 7:149281841-149281863 GCAGCTGGTGGGCGAGCGGCCGG - Exonic
1034436436 7:151064761-151064783 GGTGCAGGTGCGCTGGGTGCGGG + Exonic
1034494149 7:151410107-151410129 GCTGCAGGCGCGCGGGGTGGGGG - Intronic
1034546952 7:151795317-151795339 GCTGCTGGTCCTCGAGGAGACGG - Intronic
1036398136 8:8386140-8386162 CCGGGTGGTGCCCGAGGTGCAGG - Intronic
1036579060 8:10055485-10055507 GCTGCTGCTGCGGCAGGTGGGGG - Intronic
1037313167 8:17577279-17577301 TCTGCTGGTGCACGAAGCGCTGG + Exonic
1037658856 8:20910190-20910212 GCTGCTGATAGGGGAGGTGCTGG + Intergenic
1043387793 8:79765520-79765542 ACAGCGGGTGCGCGATGTGCGGG + Exonic
1046817198 8:118597607-118597629 GCAGCTGGTGCGAGAGGAGTTGG + Intronic
1047807270 8:128373516-128373538 GGTGCTGGTGCCAGTGGTGCTGG + Intergenic
1049417814 8:142503541-142503563 GCTGCAGGTGCAGCAGGTGCGGG + Intronic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1052358577 9:27529683-27529705 GCCGCCGGTGCGCGAGGTCCCGG + Exonic
1053715727 9:40885335-40885357 GCTGCTGGTGCCTGATGTGCGGG + Intergenic
1054076822 9:60545403-60545425 GCTGCTGGTGCCTGATGTGCAGG - Intergenic
1056604608 9:88076503-88076525 GCTGCAGGGGCTCGAGGGGCTGG - Intergenic
1057074989 9:92133996-92134018 GCGGCTGGTGCGGGAGCAGCAGG + Intergenic
1057797962 9:98171804-98171826 GCTGCCGCTGGGAGAGGTGCTGG + Intronic
1058619104 9:106864166-106864188 GCTGCTGGTGCCGGTGCTGCTGG + Intronic
1060267587 9:122121388-122121410 GCTGCTGGAGCCCAAGGGGCTGG - Intergenic
1061582357 9:131545815-131545837 GCTGCTGGAGGGGCAGGTGCTGG + Intergenic
1061609881 9:131739549-131739571 GCTGCGGGGGCGCCAGGGGCCGG - Intronic
1062499409 9:136845827-136845849 CCTGCTGGGGCGCGAGGTGCGGG + Exonic
1190221748 X:48516376-48516398 CCTGTTGGTGCTCTAGGTGCTGG + Intronic
1197643463 X:128992675-128992697 GCTGCTGGTGCCAGTGGTGGTGG + Intergenic
1197837822 X:130713954-130713976 GCTGCTGGTGGGGGAGGGGGTGG + Intronic
1201010848 Y:9547375-9547397 GCTGCGGGTGCGGGAGCTTCTGG + Intergenic