ID: 995653178

View in Genome Browser
Species Human (GRCh38)
Location 5:114395034-114395056
Sequence ACCTTCTAGAAAATAATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995653178 Original CRISPR ACCTTCTAGAAAATAATCCA GGG (reversed) Intronic
901377906 1:8853026-8853048 ACCTTGCAGAAAATAAAGCAGGG + Intergenic
901890536 1:12259603-12259625 GCCTTTAAGAAAATCATCCAAGG - Intronic
902032231 1:13431204-13431226 CACTTCTAGAAAATCATCCTTGG - Intergenic
905510569 1:38516602-38516624 ACTTTCTAGAGAATGATCTATGG - Intergenic
905694383 1:39964137-39964159 ACCTTGTAGACATTAAGCCAAGG - Intronic
906291891 1:44624789-44624811 ATCTTTAAGAAAATAATTCACGG - Intronic
908349812 1:63274147-63274169 AGCTTCCAGAATATATTCCAGGG + Intergenic
908462517 1:64359176-64359198 ACCTTCTAGAAAACTGGCCAAGG + Intergenic
909809716 1:79917564-79917586 ACATTAAAGAAAATGATCCAAGG + Intergenic
911012103 1:93291057-93291079 ATATTCTTGAGAATAATCCATGG - Intergenic
911536948 1:99111402-99111424 TCCTTCTAGAAAATGATCTAAGG - Intergenic
911970131 1:104423958-104423980 AATTTGTAGAGAATAATCCAAGG + Intergenic
915063710 1:153207563-153207585 TCCTTTTAGAAAACAATTCAAGG + Intergenic
915922960 1:159991382-159991404 ACACTCTTCAAAATAATCCACGG + Intergenic
916485521 1:165254975-165254997 ACCTCCTGGAAAAGCATCCATGG + Intronic
918112619 1:181470520-181470542 ACCTATTAGAAAATAAATCAAGG - Intronic
918113221 1:181476280-181476302 ACCTAGTATAAAATAATCAAAGG - Intronic
918378114 1:183929323-183929345 ATCTACTAGAAAATAATCCTGGG - Intergenic
918842126 1:189555125-189555147 ACCCTCTTGAATATAATCCTTGG - Intergenic
923231937 1:231994849-231994871 ACCTTCTAACTAACAATCCAGGG + Intronic
923262729 1:232282872-232282894 ACCAACTATAAAATAATCCAGGG - Intergenic
1064837203 10:19546543-19546565 ACCATCTGGTAATTAATCCAAGG - Intronic
1065619202 10:27561981-27562003 AACTTCTAGAAGCTAATACAGGG - Intergenic
1066337865 10:34498334-34498356 TAAATCTAGAAAATAATCCACGG + Intronic
1067197745 10:44137117-44137139 ACGTTCAAGGAAAAAATCCAGGG + Intergenic
1068483882 10:57631202-57631224 ACATTCTACAAAATAATGAATGG - Intergenic
1071711119 10:88050514-88050536 TTCTTCTAGAAAATAACACATGG + Intergenic
1071882979 10:89919418-89919440 TCCTGCTATAAAATAATGCAGGG + Intergenic
1075992861 10:126852797-126852819 ACCTTTTTGGAAATAATTCAAGG + Intergenic
1077531713 11:3100068-3100090 ACCTTCAAGCAAATAACCAAAGG + Intronic
1077694063 11:4377482-4377504 AAATTGTAGAAAATAATACAAGG - Intergenic
1077828752 11:5840196-5840218 ACATAATAGAAAATAATCAATGG + Intronic
1080013647 11:27482838-27482860 ACCTTCTATAATAGAATCAATGG - Intergenic
1080296362 11:30733867-30733889 TCCTTCTTGTAAATAATTCATGG + Intergenic
1081138659 11:39470803-39470825 ACCTTCTTCTAAATAATCCAGGG + Intergenic
1081476333 11:43435850-43435872 AACTTCAAGAAAATATTTCATGG + Intronic
1086120677 11:83301761-83301783 ACCTTCTGGAAAGTAAACCAGGG - Intergenic
1090217928 11:124987221-124987243 GGCTTCTAGAAAATAATCCTGGG - Exonic
1091071846 11:132572351-132572373 AACTTCTAGAAAAAAAGACATGG - Intronic
1092772359 12:11909130-11909152 ACCTTATATAAAATTGTCCAGGG + Intergenic
1093203529 12:16219305-16219327 ACCTTTCTGAAAATACTCCAAGG - Intronic
1093957583 12:25238902-25238924 AACTTCTTGAAATTTATCCAAGG - Intronic
1095480538 12:42630480-42630502 ACCTTCTAGAATTTAAAACAAGG - Intergenic
1095702184 12:45201829-45201851 ATCTTCTAAAAATTAAGCCAAGG + Intergenic
1097572013 12:61345635-61345657 ACCTTTTAGAAGAAAATCTAAGG - Intergenic
1097636422 12:62127983-62128005 ACCATCAAGAAAGAAATCCATGG + Intronic
1097639974 12:62169170-62169192 ACCTTCTACAAAATAATGGATGG + Intronic
1098189945 12:67937525-67937547 TCCTTTTAGAAAATAACCTAGGG + Intergenic
1099277699 12:80598883-80598905 ATATTCTAGAAAATACTCTATGG - Intronic
1099584273 12:84496458-84496480 AACTTCTAGAAGATAATCTTGGG - Intergenic
1099727157 12:86446578-86446600 ACAATGTAGAAAATAATGCATGG - Intronic
1099966817 12:89455656-89455678 ATGTTATAGAAAAAAATCCAAGG - Intronic
1101826247 12:108222405-108222427 ACCTTCTTGAAAATCCTGCAAGG - Intronic
1102803224 12:115755884-115755906 CCCTTCTAGGCAATACTCCAGGG - Intergenic
1104131357 12:125897485-125897507 ACGTTCTTGAAAAAAATCTAAGG + Intergenic
1104456740 12:128920593-128920615 AGCTTCTAGAATAGAATACAGGG + Intronic
1106821433 13:33468746-33468768 TGCTTCTAGAAAAGAATACATGG - Intergenic
1108560023 13:51634024-51634046 ACCTCTTAGAAATTAATCAAAGG - Intronic
1111722883 13:91969413-91969435 ATCTTCTAGAAAAAAATCATAGG + Intronic
1112293647 13:98167154-98167176 ACCTCCTAGAAAATTGGCCAAGG - Intronic
1116271997 14:42783905-42783927 AGATTGTAGAAAATAATACAAGG + Intergenic
1116421539 14:44738482-44738504 AAATCCTAGAAAATCATCCAAGG - Intergenic
1117200532 14:53385383-53385405 ACCTTCTAGAAAAGGGTCAAGGG - Intergenic
1117574154 14:57081391-57081413 ACTTCCTGGAAAATTATCCATGG - Intergenic
1119644311 14:76337519-76337541 ACCTTCTAGAAAATGAGCAATGG + Intronic
1120746810 14:88159627-88159649 ACCTTCTAGATAACAAACCCAGG + Intergenic
1120907758 14:89634988-89635010 AATTTCTAGAAAAGAATCCCAGG + Intronic
1124084906 15:26539356-26539378 AGCTTCTAGAAAAAAATATAAGG + Intergenic
1124514927 15:30359576-30359598 ATCTTCTAGAAACTGATCGAAGG - Intergenic
1124727995 15:32171186-32171208 ATCTTCTAGAAACTGATCGAAGG + Intronic
1126198374 15:45956572-45956594 ACCTTGTTGAAAATTCTCCAGGG + Intergenic
1126227369 15:46286796-46286818 ACCATCCAGAAAAAAATCCTAGG - Intergenic
1126258920 15:46663779-46663801 AACTACTAGAAAAAAATACAGGG + Intergenic
1126961371 15:53999788-53999810 ACATTCTTCTAAATAATCCATGG - Intergenic
1127219020 15:56858152-56858174 AAATTCTAGAAAATAATGGAAGG - Intronic
1127356614 15:58206968-58206990 ACCCTCTAAAAAATATTCCCAGG - Intronic
1131324102 15:91425909-91425931 ACCTTCTCCCAAATAATTCAGGG - Intergenic
1135893209 16:26375380-26375402 ATGGTCTAGGAAATAATCCAGGG + Intergenic
1137310593 16:47253377-47253399 CCCTTCTTTAAAGTAATCCAGGG - Intronic
1139440145 16:66962594-66962616 ACTTTTTAAAAAATAATTCAGGG + Intronic
1140192275 16:72828302-72828324 GCCTTCTAGAAAATAATAAGAGG - Intronic
1146043240 17:29477715-29477737 ACTTTTTAAAAAATAATCAAAGG - Intronic
1147528139 17:41246886-41246908 ACTTTGAAGAAAATATTCCAGGG + Intronic
1149854705 17:60070991-60071013 TTCTTCTAGAAAAGAATTCATGG - Intronic
1151998301 17:77627306-77627328 ACATTCTTCTAAATAATCCATGG - Intergenic
1153678317 18:7476051-7476073 ACGTTCTAGAAAATGATGGAGGG - Intergenic
1155107449 18:22681554-22681576 AGCTTCTAAACAAGAATCCAAGG - Intergenic
1155724682 18:29065794-29065816 ACTTTCCTGTAAATAATCCAGGG + Intergenic
1157269445 18:46260209-46260231 GCCTTCTAGAAACTGATTCATGG + Intronic
1157841661 18:50965094-50965116 ATTTGCTAAAAAATAATCCAGGG + Intergenic
1158724380 18:59956189-59956211 ACCATGTAGACAAAAATCCATGG + Intergenic
1158850103 18:61487411-61487433 ACCTTCTAGAAAGTTAGGCAGGG + Intronic
1159330950 18:66993369-66993391 ACCTTCTGGAAAACAGCCCAGGG + Intergenic
1159713225 18:71789690-71789712 AATTTATAGAAAATAATCTAGGG + Intergenic
1159868388 18:73732701-73732723 ACCTCCTAGAAAATAAAGAATGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160477810 18:79208410-79208432 ACCTTGAAGAAAAGGATCCAAGG + Intronic
1161858496 19:6779809-6779831 AGCTTCTAAAAAATAATAAAAGG + Intronic
1166403208 19:42499602-42499624 ATTTTCTACAAAATAATTCATGG - Intergenic
925316429 2:2929850-2929872 ACTTTCAAGAAAAAAATACAAGG - Intergenic
925616067 2:5745532-5745554 CCCATCTAGTAAATACTCCAGGG + Intergenic
925917837 2:8619370-8619392 TCCTTCTAGAACATTCTCCAGGG - Intergenic
926467470 2:13208417-13208439 ACTCTCTAGAAATTAATCTAAGG + Intergenic
927139660 2:20121068-20121090 ACTGTCTAGAAAATAATAGAAGG - Intergenic
927662842 2:25007333-25007355 ACCGTGTAGTTAATAATCCATGG - Intergenic
927694927 2:25233138-25233160 TCCTTTTAGAAAACAATCAAAGG + Exonic
930562674 2:52980134-52980156 ACCTTAGAGAAAATAAGCCAAGG - Intergenic
930721905 2:54646194-54646216 ACCCTCCAGAAAGAAATCCAGGG + Exonic
931029083 2:58150881-58150903 ACATACTAATAAATAATCCATGG - Intronic
933655446 2:84882891-84882913 ACCTACTTCTAAATAATCCACGG - Intronic
940188481 2:151012937-151012959 ACCTTCAAGAAATTTATCCTAGG - Intronic
940820236 2:158345846-158345868 GCCTTCTAAAAACTTATCCAAGG - Intronic
941406258 2:165092511-165092533 ACTTTCTAGAACAAATTCCAAGG - Exonic
941591485 2:167426008-167426030 ACCTTCAAAGAAACAATCCAAGG + Intergenic
943329453 2:186541848-186541870 GCCTTCTCGCAAATAATCCTGGG + Intergenic
943468947 2:188267964-188267986 ACTTTATAGAAAAAAATGCAAGG - Intergenic
944614259 2:201443899-201443921 TCCTTCTTAAAAAAAATCCAGGG + Intronic
945007143 2:205420761-205420783 ACCTGCTTGCAAATAATACAAGG - Intronic
945172124 2:207007712-207007734 CCCTTCAACAAAATATTCCAAGG + Intergenic
945371786 2:209027578-209027600 AGTTTCTTTAAAATAATCCATGG + Intergenic
946783524 2:223218585-223218607 ACCTTCTGGAAACTCCTCCATGG + Intergenic
947014457 2:225602563-225602585 AACTCCTAGAAAAAAATGCAGGG - Intronic
947908215 2:233781821-233781843 AACTACTAGAAAATAATCATTGG - Intronic
948068411 2:235100200-235100222 GCCTTTTAAAAAATAAACCAAGG - Intergenic
1168859366 20:1035026-1035048 GTCTTCAAGAAAAGAATCCAGGG - Intergenic
1171540868 20:25954533-25954555 ACCTTCAAGACAGTGATCCAGGG - Intergenic
1171939411 20:31311248-31311270 ACCTTCTGAAAAAAAATTCAAGG - Intergenic
1171968350 20:31547495-31547517 AACTTCTTGAACATGATCCAGGG - Intronic
1173351521 20:42249854-42249876 ACATTCTAGAGAGTAGTCCAGGG + Intronic
1175535635 20:59709118-59709140 ACGTTGTAGAAAATAATCCCTGG - Intronic
1175628475 20:60510505-60510527 AGCTTCTAGTAAACAATCAAAGG - Intergenic
1177162805 21:17566727-17566749 ACCCTCTTGAATATAATCCCTGG + Exonic
1179079356 21:38156261-38156283 ACTTTGTAGAAAATGATTCATGG - Intronic
1179177854 21:39021769-39021791 GCCTTCAAAAAAATAATCCCAGG + Intergenic
1179804011 21:43825935-43825957 ACCTTCTAGACCACATTCCAGGG - Intergenic
1184278656 22:43425160-43425182 ACCTTCTACAACATCAACCAGGG + Exonic
1185282687 22:49982143-49982165 ACGCTCTTGAAAATAATCAAAGG + Intergenic
949808351 3:7978940-7978962 ATTTACTAGAAAGTAATCCAGGG - Intergenic
950664398 3:14486449-14486471 ACCTTCTAGAAAACTCTCCTAGG - Exonic
954174886 3:48836532-48836554 AACTTCTAGAAGAAAATACAGGG + Intronic
954551936 3:51489011-51489033 ACCTTCTAGAACATGATAAAGGG + Intronic
955162490 3:56478171-56478193 ACTTTGAAGAACATAATCCAGGG - Intergenic
955696262 3:61640445-61640467 AACTTGTAGAACATAAACCAAGG + Intronic
956159195 3:66330894-66330916 TCCTTCAAGAACAGAATCCATGG + Intronic
956375829 3:68612709-68612731 TCCTTCTAGCAAATTATCCTTGG - Intergenic
956538854 3:70311294-70311316 GCCTTCTAGTAAATAATCACAGG + Intergenic
957739568 3:84247310-84247332 AACTTCTAAAAAAAAAGCCAAGG - Intergenic
958703804 3:97627466-97627488 ACCTGAGAGAAAATATTCCAGGG + Intronic
958894149 3:99811550-99811572 ACATTCTAAAAAAAAGTCCAGGG + Intergenic
959086564 3:101856405-101856427 ACCTTTTGGATAATAATTCATGG - Intronic
963098494 3:141573371-141573393 ACATTCTAAAAACTAATCCTAGG - Intronic
963383758 3:144564565-144564587 CCTTTCTAAAAAATAATCTAAGG + Intergenic
963667800 3:148211815-148211837 ACCTTCTGGAACTTTATCCAGGG + Intergenic
964850115 3:161087010-161087032 AACTACTACAAAATAATCAAAGG - Intronic
965489674 3:169320980-169321002 ACTTACCAGAAAATAACCCAGGG + Intronic
965931429 3:174047984-174048006 ACCTTCTAGAAAGCAATTAAAGG + Intronic
967346196 3:188458627-188458649 ACTATCTTCAAAATAATCCAGGG - Intronic
967509566 3:190293401-190293423 ACCTTGTAGATCATATTCCAAGG + Intergenic
972659178 4:41097673-41097695 ACCTTCAAAAAAATTAGCCATGG - Intronic
973228308 4:47811663-47811685 ACCAATTAGAAAATAATCCTCGG - Intronic
973595797 4:52488461-52488483 ACATGCTTCAAAATAATCCATGG + Intergenic
974478449 4:62414125-62414147 ACCATCTTGAAATTAACCCAAGG + Intergenic
975480525 4:74874853-74874875 TCCTTCCAGTAAATACTCCATGG - Intergenic
976756447 4:88503104-88503126 AGCTTCTAGAAGAAAATACAGGG - Intronic
978867205 4:113528014-113528036 ACCTTTTACAAAATAAAACAAGG + Intronic
979020700 4:115493698-115493720 AAATTCTAGAAAATAGTCAAAGG + Intergenic
979321312 4:119328331-119328353 TCCATCTAGAAAATAATATACGG + Intergenic
979545065 4:121931292-121931314 AGCATCTAGAAAATAATTCAAGG + Intronic
979781093 4:124651840-124651862 ATATTTTAAAAAATAATCCAAGG - Intergenic
981766188 4:148252869-148252891 TTGTTCCAGAAAATAATCCAAGG - Intronic
981813737 4:148805007-148805029 ATTTTCTAGAAAAAAATCCTTGG + Intergenic
982946031 4:161624401-161624423 ACCTTCTGAATAATAATTCAGGG + Intronic
983328193 4:166287616-166287638 ATTTTCTTGAAAATAATCTATGG + Intergenic
986452077 5:7876047-7876069 ACCTACTAGAAAAAAATTAAGGG - Intronic
987775986 5:22367061-22367083 TACTTCTAGAAAATAATCGAAGG + Intronic
988218744 5:28314341-28314363 ACTTTTTAGAAAAAAATTCAAGG + Intergenic
991505740 5:67322112-67322134 AATTTCTAGTAAATTATCCAAGG + Intergenic
992657669 5:78926719-78926741 ATCTTCAACAAAATAATCCCTGG + Intronic
993112713 5:83678478-83678500 ACCTTACAGAAAATAAACCACGG - Intronic
993180430 5:84545852-84545874 ACCTTAGAGATGATAATCCAAGG - Intergenic
993644725 5:90448091-90448113 ACTTTCTAGAAAGTAAACCAAGG - Intergenic
994159755 5:96543689-96543711 AACTTCTAGAAGATAATGTAGGG - Intronic
995653178 5:114395034-114395056 ACCTTCTAGAAAATAATCCAGGG - Intronic
996551207 5:124732402-124732424 TACTTCTAGAAAATAATGCTAGG + Intronic
999087014 5:148901791-148901813 ACCTTCTTGAAAGTAATCCAGGG - Intergenic
999876124 5:155808021-155808043 ACCTTATAAAAAATAAGCCTTGG + Intergenic
1000758977 5:165197491-165197513 ATCTTCTAGAGAATATTCTAGGG + Intergenic
1003684602 6:8289045-8289067 AACTTCTAGAAGATAACACAGGG - Intergenic
1005267088 6:24123475-24123497 CCCTTCTGGAAAACAACCCAGGG + Intergenic
1006711213 6:36073199-36073221 ACTTGCTTTAAAATAATCCAGGG - Intronic
1007364403 6:41381205-41381227 ACATTATAGAAAAAGATCCAAGG + Intergenic
1010842057 6:80658021-80658043 ACATTCTAGAAAAGAAAACAAGG - Intergenic
1011505532 6:88038299-88038321 ACATTCTGATAAATAATCCATGG + Intergenic
1015194058 6:130506043-130506065 CCCAACTAGAAAATAACCCAAGG + Intergenic
1015421847 6:133019978-133020000 ACATTCTAGAAAATACTATAAGG - Intergenic
1016358473 6:143243134-143243156 TCCTTTTAGAAAAAAATCCTTGG + Intronic
1022308027 7:29168513-29168535 ATTTTCTTCAAAATAATCCAGGG - Intronic
1023956492 7:44890762-44890784 ACCTACTTCAAAATAATCCTCGG - Intergenic
1025948365 7:66122862-66122884 ACTGTCTAGAAAAAAGTCCAGGG - Intronic
1027469717 7:78557657-78557679 ACCTTCTAGAAAGTATTTCTGGG - Intronic
1028271417 7:88795347-88795369 AACTTTTAAAAAAAAATCCAAGG + Intronic
1031550371 7:123104234-123104256 ACCTTGCAGAAAATGCTCCAGGG + Intergenic
1032878628 7:136065274-136065296 ACCGGCCAGAAAATATTCCATGG + Intergenic
1032905502 7:136359975-136359997 ACCTACTAGAAATTAATCTTGGG - Intergenic
1033536283 7:142314770-142314792 AACTTCTAGACCATGATCCATGG - Intergenic
1035347780 7:158216960-158216982 ACATGTTATAAAATAATCCATGG + Intronic
1038166880 8:25094112-25094134 ATCTTCTAGAATATAATACAGGG + Intergenic
1038258529 8:25972543-25972565 ACAGTCTATGAAATAATCCAAGG - Intronic
1038630749 8:29241408-29241430 ATCTTTTAAAAAATAAACCAGGG + Intronic
1039440277 8:37590413-37590435 AGCTTCTAGATAATACTTCAGGG + Intergenic
1039662659 8:39483911-39483933 TCCTTCTAGAAAATTTACCAAGG + Intergenic
1040281099 8:46044292-46044314 CCCTTCTAAAAAATAATAAAAGG + Intergenic
1040917583 8:52579186-52579208 AACTTCTAGAAGAAAATCTAGGG + Intergenic
1041993669 8:64026556-64026578 ACCTGCAGGAAAATAACCCAGGG - Intergenic
1042574573 8:70203944-70203966 ACATTAGAGAAAATATTCCATGG + Intronic
1045342875 8:101270078-101270100 GCCTTGAAGAAAATAAACCAGGG + Intergenic
1045704519 8:104905878-104905900 AACTTCTAGAAAAAAAAACATGG - Intronic
1046001342 8:108424227-108424249 TATTTCTAGAAAATAATCCATGG + Intronic
1046664360 8:116983397-116983419 ACACTTTAGGAAATAATCCAAGG + Intronic
1046701920 8:117410548-117410570 AATTTTTAGAAAATAATCAAAGG + Intergenic
1048078612 8:131100521-131100543 AACTTCTAGAAAATAAAAAATGG - Intergenic
1048201678 8:132379845-132379867 AGCTTCTAGAAAGTAAATCAGGG - Intronic
1048256236 8:132907051-132907073 TCCTTCTAGAAAATGCTCCATGG - Intronic
1048379842 8:133855709-133855731 ACCTTTAAGACAATAAGCCAGGG - Intergenic
1048480847 8:134791262-134791284 AACTTCTACACAATAACCCAGGG - Intergenic
1049005900 8:139855564-139855586 ACCTTCTAGATAAGATTCCCTGG + Intronic
1052250822 9:26395150-26395172 ACCTCCTAGAAGATAATGCAGGG - Intergenic
1052341098 9:27364950-27364972 AACTAGTAGAAAATAATGCAAGG - Intronic
1052555928 9:30017350-30017372 ACATTATATAAAATAATCCTAGG + Intergenic
1053237909 9:36472599-36472621 ACCATTTAGAAAATGATCTATGG - Intronic
1054778986 9:69149179-69149201 ACTTTCTCTATAATAATCCAAGG - Intronic
1057709956 9:97431054-97431076 ACCTTCTAGAAAAAATGGCATGG - Exonic
1060028457 9:120192901-120192923 ACCTACTGGAAAATCATCCAAGG + Intergenic
1187426694 X:19183876-19183898 ACCAACTAGAAAATACTCCTAGG - Intergenic
1188236161 X:27733629-27733651 AATTTCTAGAAAAAAATACATGG - Intronic
1193587537 X:83343915-83343937 ACCATGCAGAAAAAAATCCATGG + Intergenic
1194183512 X:90742227-90742249 ACCTTGTAAAAAATAAATCAAGG + Intergenic
1195470596 X:105225623-105225645 ACCTTTGAAAAGATAATCCAGGG - Intronic
1195746431 X:108123202-108123224 ACCTTGTAGAAACTAATTCTTGG + Intronic
1195955263 X:110322087-110322109 AACAACTAGAAAACAATCCAAGG - Intronic
1196120691 X:112047275-112047297 ACTTTCAAGAAAATATTCAATGG - Intronic
1200530122 Y:4324172-4324194 ACCTTGTAAAAAATAAATCAAGG + Intergenic
1201449129 Y:14091228-14091250 ACCATATAGAAAATAGTCCCTGG - Intergenic