ID: 995653735

View in Genome Browser
Species Human (GRCh38)
Location 5:114401455-114401477
Sequence CTGTTAACTGAGAAATAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995653734_995653735 -4 Left 995653734 5:114401436-114401458 CCAGTGATTAGGATAGTCACTGT 0: 1
1: 0
2: 0
3: 5
4: 117
Right 995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG 0: 1
1: 0
2: 1
3: 31
4: 296
995653733_995653735 1 Left 995653733 5:114401431-114401453 CCTATCCAGTGATTAGGATAGTC 0: 1
1: 0
2: 1
3: 4
4: 70
Right 995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG 0: 1
1: 0
2: 1
3: 31
4: 296
995653730_995653735 29 Left 995653730 5:114401403-114401425 CCACAAGCACATTTAATTGATAT 0: 1
1: 0
2: 1
3: 13
4: 208
Right 995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG 0: 1
1: 0
2: 1
3: 31
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995653735 Original CRISPR CTGTTAACTGAGAAATAACA AGG Intronic
902025753 1:13382316-13382338 GGGATAAATGAGAAATAACAGGG + Intergenic
902145045 1:14391634-14391656 GTGTTAACTGTGAACTAACAGGG - Intergenic
902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG + Intronic
902861870 1:19252324-19252346 CTATTAACTGACAACTAAGAAGG - Intronic
903844056 1:26266425-26266447 GTATTAACTGAGAAACAACAGGG - Intronic
904120281 1:28193715-28193737 CTCTTACCTGAGAAACAGCAGGG + Intronic
907012917 1:50979734-50979756 CTGTCCACTGAGAAGGAACAGGG - Intergenic
908240622 1:62186187-62186209 CTGTAAAATGAGAAATACTATGG - Intergenic
908822309 1:68101164-68101186 CTGTTAACTGAAGAATCACAAGG - Intronic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
910447296 1:87311688-87311710 TTGGTAATTGAGAAATAAAATGG - Intergenic
911810596 1:102273107-102273129 CTGATCACTTAGAAATAAAAAGG - Intergenic
913229826 1:116732498-116732520 CTGTCAACTGAAGAATCACAAGG + Intergenic
915483276 1:156202075-156202097 CAGTGAACTGAAGAATAACAAGG - Intronic
916313036 1:163417796-163417818 CTGATAAATGAGAATCAACATGG - Intergenic
917020743 1:170583521-170583543 CTGTTCCTTGAGAAATAAAATGG - Intergenic
918554942 1:185787494-185787516 CTGTTGTCTGAGAGCTAACAGGG + Intronic
918792991 1:188855313-188855335 ATGTTAGCTAAGAAGTAACATGG - Intergenic
918988838 1:191670792-191670814 ATGTAAACTGAGGTATAACAAGG - Intergenic
919558133 1:199086794-199086816 GTGTTAACTGAGAAAGAAGTAGG - Intergenic
921049640 1:211501872-211501894 CTGTGAGAAGAGAAATAACACGG - Intergenic
922063855 1:222117099-222117121 CTGTTTAGTGAGAAATGATATGG + Intergenic
923175047 1:231455455-231455477 CTGTTAACATAGAAATATAAAGG + Intergenic
923262463 1:232280480-232280502 TTTTTATCTGAGAAATGACAAGG - Intergenic
1062777389 10:164243-164265 CCGTTAATTGAGAAAGAACTCGG - Intronic
1063513971 10:6675656-6675678 CTGTTAACTGCCATATAAGAAGG - Intergenic
1064276336 10:13908750-13908772 CTGATAACTGAGTAAAAACATGG - Intronic
1064617522 10:17176799-17176821 CTGTATACTAAGAAATATCAAGG - Intronic
1064815152 10:19252384-19252406 CTGTTAACTGTGGAATCACTTGG + Intronic
1065049349 10:21775153-21775175 CTTTTAAGTGAGAAAAAAAAAGG - Intronic
1065449148 10:25837929-25837951 CTGATAAATGAGAAATCACGTGG + Intergenic
1065575338 10:27112498-27112520 CTGTTTACTGTGAAGTAACTAGG - Intronic
1068122579 10:52798330-52798352 CTCTGAACTGACCAATAACAAGG - Intergenic
1070447016 10:76515112-76515134 CTGAGAACTAAGAAATACCATGG + Intronic
1071174217 10:82905249-82905271 CAGTGAACTGAGAAAATACAAGG - Intronic
1072027818 10:91480092-91480114 CACTTAACTGAGATGTAACAGGG - Intronic
1074123770 10:110512295-110512317 CAGTCAGCTGATAAATAACAGGG + Intergenic
1074822476 10:117191251-117191273 TGGTGAACTGAGAAACAACATGG - Intergenic
1074863348 10:117530012-117530034 ATGTTAACTGAAAAAAAAGAAGG - Intergenic
1074990232 10:118699306-118699328 CTGTTTACTTGGAAATAAAAAGG + Intronic
1075123376 10:119680680-119680702 CTGCTAAGGGAGAAATACCAAGG - Intergenic
1075932504 10:126311470-126311492 CTGTCACCCGAGAAATTACAGGG - Intronic
1077596844 11:3540034-3540056 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1077767354 11:5174396-5174418 CTGTTAGATGAGAAAAAAAATGG + Intronic
1078000931 11:7495012-7495034 CTGTTAACTGAGCAAAAAGTGGG - Intronic
1078926757 11:15882043-15882065 CTTTCAACTGAGAGGTAACATGG + Intergenic
1078980699 11:16529738-16529760 CTGATACCTGAGAATGAACAAGG - Intronic
1079418305 11:20261391-20261413 CTCTTATCTGAGAAATAGCAAGG + Intergenic
1080556168 11:33419209-33419231 CTCTCAACTTAGAAATAAAATGG + Intergenic
1080787531 11:35489280-35489302 CTGTTAAGTGAGTAATAAAAGGG - Intronic
1080820948 11:35805940-35805962 CTGTTAGGAGAGAAAAAACAAGG - Intronic
1081089815 11:38849525-38849547 CTGAGAACTGTCAAATAACAAGG - Intergenic
1081521037 11:43881147-43881169 CTGTTTACTGAGGAAAAACTGGG + Exonic
1082692414 11:56322974-56322996 CTGATATCTCAGAAATAAAATGG + Intergenic
1082740616 11:56906968-56906990 TTGTGAACTGAGTAAGAACATGG + Intergenic
1084252762 11:67913988-67914010 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1084820101 11:71682036-71682058 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1085661369 11:78370394-78370416 ATGCTAAGTGAAAAATAACAAGG + Intronic
1086217547 11:84402045-84402067 CAATGAACTGAGAAAAAACAAGG - Intronic
1086541809 11:87921790-87921812 CTGCTATCTGAGAAAAAAAAAGG - Intergenic
1087366872 11:97231240-97231262 TTGTTAACTGTAAAATAACAGGG - Intergenic
1090114030 11:123947244-123947266 CTGCAAACTGAGAGGTAACAAGG - Intergenic
1090148415 11:124354378-124354400 CTTTTTGCTGAGACATAACATGG - Intergenic
1091576231 12:1738453-1738475 CTCTAAAATGAGAAATTACAGGG - Intronic
1093400922 12:18745670-18745692 TTGATAAGTGAAAAATAACAAGG - Intergenic
1093620440 12:21282516-21282538 CTGTAATCTGGGACATAACAAGG + Intronic
1096267768 12:50137742-50137764 CTGTAAACTGAGAAAACATAAGG + Exonic
1098165813 12:67696380-67696402 CTGTTTTCTGAGAAATAAGAAGG + Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1098703320 12:73656298-73656320 CTTATAGGTGAGAAATAACACGG + Intergenic
1099355968 12:81636087-81636109 CTGTTAAATGTGAAAGAATATGG + Intronic
1101282322 12:103271087-103271109 CTGTTGCCTGATACATAACAAGG - Intronic
1103261323 12:119591835-119591857 CTGTCACCTGAGGAATAAGAAGG + Intergenic
1106019381 13:25900024-25900046 CTGTCAACTGAAGAATAACCAGG + Intronic
1106591188 13:31099926-31099948 CTGTCGACTCAGAAATTACAGGG + Intergenic
1106812349 13:33371705-33371727 TTGTAAAGTGAGAAATAAAACGG + Intergenic
1106965169 13:35055847-35055869 CTGTGAAATGAGAAATGAGAGGG + Intronic
1108852286 13:54746533-54746555 CTTTTCCCTGATAAATAACATGG + Intergenic
1108948354 13:56053531-56053553 CTGATAACAGAGAAAAAACAAGG + Intergenic
1109601171 13:64630350-64630372 TTGATAACAGAGAAAGAACACGG - Intergenic
1110150031 13:72240139-72240161 CTGTTAATTAAGAATTAACGAGG - Intergenic
1110218505 13:73049081-73049103 ATGTGAACTGAGAAATAATGAGG - Intergenic
1110809686 13:79798075-79798097 CTATAATCTGGGAAATAACAAGG + Intergenic
1113158397 13:107351783-107351805 CTGTCAACTGAGGAATTGCAAGG + Intronic
1113268697 13:108648399-108648421 CTGTGAACTAAGACATAAAAAGG - Intronic
1115263387 14:31475837-31475859 CTGTCAACTGAAGAATGACAAGG - Intergenic
1117369717 14:55066054-55066076 ATGTTATCTAATAAATAACAAGG - Exonic
1117895690 14:60484458-60484480 ATGTTATCAGAGAAATAGCAAGG - Intronic
1121401573 14:93682854-93682876 CTGTCAAATGGGATATAACAGGG + Intronic
1127957337 15:63864517-63864539 CAGTGGACTGAGGAATAACAAGG + Intergenic
1129933968 15:79433749-79433771 CTGGTGTCTGAGAAATGACAAGG - Intronic
1130315998 15:82797501-82797523 TTGTTAAATGAAAAATAAAATGG - Intronic
1130792029 15:87165515-87165537 CTGTTAACTCATAATTCACAGGG + Intergenic
1131924565 15:97368135-97368157 CTTTTAATTGAGAGATAAAAAGG + Intergenic
1132268629 15:100503193-100503215 CTCTTAATCGGGAAATAACAAGG + Intronic
1133375240 16:5280748-5280770 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1140060917 16:71568923-71568945 CTGATCACTGATAAATAAGAGGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146595760 17:34167082-34167104 CAGTAAACTGAGGCATAACAAGG + Intronic
1148408877 17:47447165-47447187 CTTTGAAGTGGGAAATAACAAGG - Intergenic
1148472287 17:47902379-47902401 CTCTGAGCAGAGAAATAACATGG + Intronic
1148845509 17:50527635-50527657 CTGCTCACTGAGAAGGAACAAGG - Intronic
1149010805 17:51854416-51854438 CTGTTAACTTACAAATTGCATGG - Intronic
1149760184 17:59221610-59221632 CTGTTATCTGGGAAATTAGAGGG - Intronic
1151888822 17:76940241-76940263 CTGTTATGTGAGCTATAACAGGG - Intronic
1153402267 18:4694151-4694173 CTGTTACATGATAGATAACATGG - Intergenic
1155691931 18:28635222-28635244 GTGTTAACTTAAAAATCACAAGG + Intergenic
1157718651 18:49906665-49906687 CAGTGAGCAGAGAAATAACATGG + Intronic
1158441377 18:57477244-57477266 CTGTGAACTTGGACATAACATGG - Exonic
1159067611 18:63587618-63587640 AGGTTAACTCAGAAATAAAATGG - Intronic
1160104969 18:75965427-75965449 CTGTTTTCTGAGAAATGACTTGG + Intergenic
1160626054 18:80206157-80206179 CTGTTTCCTGAGAGAAAACAAGG + Intronic
1163220567 19:15915651-15915673 CTGTTAAATGAGAAAAGATATGG - Intronic
1164131378 19:22365301-22365323 CTGTTACCTGAGAAATCAACTGG + Intergenic
1165504605 19:36217537-36217559 TTGTTAACTGAGAGAAAGCAAGG + Intronic
928904262 2:36354815-36354837 CCGTGAACTGAGAAAGAAAATGG + Intergenic
929066801 2:37984566-37984588 CTGTTAACAGAAAAATGACTAGG - Intronic
930241446 2:48939595-48939617 CTGGTAAATGTTAAATAACAAGG - Intergenic
930291188 2:49494754-49494776 CTGATAACGAAGAAATAAAAAGG + Intergenic
931325699 2:61220118-61220140 ATGTTACCCAAGAAATAACATGG + Intronic
931797081 2:65721557-65721579 CTGTTAAATGAGAGTTAATAAGG + Intergenic
933242484 2:79938052-79938074 CTGTTAAATTAGAAAACACATGG + Intronic
933304792 2:80584063-80584085 CTGTTAAGTTGGAAATAAGAGGG + Intronic
935061009 2:99607650-99607672 CTTTTAACTGACAAGTAACTTGG + Intronic
935367661 2:102311470-102311492 CTCTTAACTGATAAAGAAAATGG + Intergenic
935533426 2:104263139-104263161 CTGCTAATTAATAAATAACACGG + Intergenic
936406188 2:112206380-112206402 CTGTAAACAGAAAAATAATAGGG - Intergenic
939021504 2:136963224-136963246 CTCTCAACTGAAAAATAAGATGG - Intronic
940733908 2:157427597-157427619 CTGATAACAGAGAAAGAAAATGG + Intronic
940937636 2:159516356-159516378 CTTTTAACTGAAAAATATCACGG - Intronic
941268217 2:163390816-163390838 TTGATAACTGAGAAATAATTAGG - Intergenic
943135248 2:183902291-183902313 CTGTCAACTGAAGAATGACAAGG - Intergenic
943524036 2:188994341-188994363 CAGTCAACAGAGAAAAAACAAGG - Intronic
943824299 2:192369637-192369659 CTGCTATCAAAGAAATAACAAGG + Intergenic
944199106 2:197086432-197086454 CTTTTAACTGAAAAAAAAAAGGG + Intronic
944712968 2:202352212-202352234 CTGTAAAATGAGAAATATAATGG - Intergenic
944949151 2:204727493-204727515 CTGTCAACTGAAGAATGACAAGG + Intronic
948426536 2:237890688-237890710 CAGTTAACTGAGAAATCTGAAGG - Intronic
1169406944 20:5329626-5329648 ATGTTAACTGAAAAATCACAAGG + Intergenic
1169563181 20:6824242-6824264 CTTTTAATTGAGAAATACCAGGG + Intergenic
1169730430 20:8779995-8780017 CTGTTCATTGAGAGATATCATGG - Intronic
1175544830 20:59771448-59771470 CTGAGACCTGAGAAATGACAAGG - Intronic
1177671157 21:24229563-24229585 CTGATAACAGAGAAATACAAAGG - Intergenic
1179046787 21:37851858-37851880 TTGATATCTGAGGAATAACATGG + Intronic
1179621661 21:42620261-42620283 CTGTTAACTGACAAATGATGAGG + Intergenic
1182806063 22:33071615-33071637 CTGTTAACTGTGTGAGAACAGGG - Intergenic
1183718256 22:39546960-39546982 CTCTGAGCTTAGAAATAACATGG - Intergenic
1184990477 22:48165446-48165468 CTCCTGACTGAGCAATAACACGG - Intergenic
949500388 3:4674671-4674693 TTGTTAACTCAGAAGTAACAAGG - Intronic
951176258 3:19604244-19604266 CTGTTCACTGACAATGAACATGG - Intergenic
951700344 3:25490074-25490096 CTGACAACTGAAAAATAACAGGG - Intronic
951832959 3:26950716-26950738 CTGTTTACATAGACATAACAAGG - Intergenic
952614181 3:35249687-35249709 TTTTTATCAGAGAAATAACATGG + Intergenic
952676451 3:36036907-36036929 ATGTTAACTGAAAAATAACAAGG - Intergenic
952699323 3:36309133-36309155 ATGATAAATGAGAAACAACAAGG + Intergenic
953360089 3:42288347-42288369 CTGTTAACTAAAAAATCCCATGG - Intergenic
954812585 3:53257139-53257161 ATGATAACTGAGAAATTACTAGG + Intergenic
955818303 3:62871036-62871058 CTGTGAATTGAAATATAACATGG - Intronic
957675676 3:83361189-83361211 CAGTTGACTGTGGAATAACATGG - Intergenic
958266753 3:91446809-91446831 CTGTGAAATGAAAAATTACAGGG - Intergenic
958796245 3:98709378-98709400 CTTTGAACTGAGAAATACTATGG + Intergenic
959104979 3:102055231-102055253 CTGTTGACTAAGAATAAACAGGG + Intergenic
960160056 3:114340462-114340484 CAGTAAACTGAGGAAAAACAAGG - Intronic
961900438 3:130205350-130205372 CTGTTACCAAAGAAATAAAAAGG + Intergenic
962016998 3:131451790-131451812 AAATTAACTTAGAAATAACAGGG + Intergenic
963492043 3:146014450-146014472 CTTTTAAATGAAAAATAACTTGG + Intergenic
963704932 3:148674994-148675016 CCTTTACCTTAGAAATAACATGG + Intergenic
963709830 3:148734614-148734636 CTATTCACTCAGAAATAGCAGGG + Intronic
964010652 3:151887740-151887762 CTTTTAAGAGAGAAATAAAATGG - Intergenic
964011605 3:151898631-151898653 CTTTTAAGAGAGAAATAAAATGG + Intergenic
964041207 3:152263984-152264006 CGGTGAAGTGAGAAATAACTGGG - Intronic
964421472 3:156508708-156508730 CTGTAAAGTGAGAAATGATATGG - Intronic
965675395 3:171189892-171189914 ATGTTAACTAAGAAAAAAAATGG + Intronic
966005012 3:174999993-175000015 CTTTTAACTAAGAAATCAGAAGG + Intronic
966300056 3:178468900-178468922 CTGTAAACTTAGAAACAAGATGG + Intronic
966357697 3:179099399-179099421 AGGATAACTGAGAAATCACATGG + Intergenic
969011419 4:4066527-4066549 CTGTTACCAAAGAAATAAAAAGG + Intergenic
969127709 4:4965414-4965436 ATGTTAACTGGGAAACAGCAGGG + Intergenic
969288653 4:6224309-6224331 CTGCTAACTGGGAAGCAACAAGG - Intergenic
969742651 4:9043360-9043382 CTGTTACCAAAGAAATAAAAAGG - Intergenic
969802031 4:9575470-9575492 CTGTTACCAAAGAAATAAAAAGG - Intergenic
970870861 4:20815409-20815431 GTGATATCTGAGTAATAACATGG - Intronic
971157457 4:24098607-24098629 CGCTTAAGTGAGAAATAACCTGG + Intergenic
971458935 4:26873501-26873523 CTGCTAACAAGGAAATAACAAGG - Intronic
971466289 4:26965934-26965956 CTGTTATGTGAGAAAAAACAAGG - Intronic
971843375 4:31885659-31885681 ACGTTAAATGAGTAATAACAGGG + Intergenic
971846493 4:31924994-31925016 CTGTCAACTGAAGAATCACAGGG - Intergenic
971905896 4:32725496-32725518 CTGTTAAATGAAAAAGAACAAGG + Intergenic
972119994 4:35689010-35689032 CTGTTATTTGAGAAATACAATGG + Intergenic
972164874 4:36271455-36271477 CTATTTACAGAGAAATGACACGG + Intergenic
973075655 4:45922551-45922573 ATGTAAAGTGAGAAATAATAAGG - Intergenic
973172802 4:47166209-47166231 CAGTTGACTCAGGAATAACATGG + Intronic
974166682 4:58213504-58213526 CTGTCAACTGAAGAATCACAAGG - Intergenic
974226660 4:59053758-59053780 CCTTTAGCTGAGAAATATCAGGG + Intergenic
974297427 4:60020115-60020137 CTGTTGACAGAAACATAACATGG + Intergenic
976965261 4:91031453-91031475 CTGGTGACTGATATATAACAAGG + Intronic
977645237 4:99404492-99404514 CTGTTAAGTAAAAAATAACTAGG - Intergenic
977824544 4:101515322-101515344 TTGTTAACTGTGAATTCACAGGG + Intronic
978195389 4:105966102-105966124 CTGTTAACTGAAAACTAAATGGG + Intronic
978482806 4:109213564-109213586 CTGTTAACTGGGAGATTAAATGG - Intronic
978972315 4:114823599-114823621 ATGTTATCAGAAAAATAACAAGG + Intergenic
979874541 4:125871581-125871603 CTGTTCCCTGTGAAATAAAAGGG - Intergenic
979955081 4:126942791-126942813 ATGTTTACTGAGAAACTACAGGG + Intergenic
980581258 4:134755253-134755275 CTGTCCATTAAGAAATAACAAGG - Intergenic
981099354 4:140813277-140813299 TTTTTAACTGACAAATAAAATGG - Intergenic
982855093 4:160371912-160371934 CTTTTCACTGAGGGATAACATGG + Intergenic
982985600 4:162202498-162202520 CTACTAACAGAGAAATAACGAGG - Intergenic
983093579 4:163536468-163536490 CTGCACACGGAGAAATAACATGG - Intronic
983470641 4:168150410-168150432 CTGTCAGCTGAAGAATAACAAGG + Intronic
983588260 4:169379422-169379444 CTGATAACTCAGAAATAAAAAGG + Intergenic
984104270 4:175525456-175525478 ATGTCAACTCAGAAAGAACATGG - Intergenic
984114501 4:175662841-175662863 ATATTAACTTAGAAATGACATGG + Intronic
984401768 4:179274792-179274814 ATATTAACTGAGAAATAACTGGG + Intergenic
986586881 5:9327873-9327895 CTGTTAACTGAAAAACAGAAAGG - Intronic
986683197 5:10251791-10251813 CTGTTAAGTGGAAAATAAAATGG - Intronic
986691754 5:10319090-10319112 TTGTCAACTGAGGAATGACAAGG + Intergenic
986998079 5:13629973-13629995 CTGTTAACTGAGATATGAATTGG + Intergenic
988741606 5:34079262-34079284 CTGTTTTCTGAGAAATAAAAAGG - Intronic
988943579 5:36171145-36171167 CTGCTAACTGAGCAAAAACGAGG - Intronic
989568056 5:42920843-42920865 TTGTTAACAAAGAAATAACTTGG - Intergenic
989661106 5:43798381-43798403 CTGTTAACTGCAAAGTCACAGGG + Intergenic
989972082 5:50536555-50536577 CTGTCAACTGAAGAATGACAAGG - Intergenic
990058354 5:51614594-51614616 CTTTTAAGTGAGAAATATGAAGG + Intergenic
990769940 5:59231803-59231825 CTGTTAACCGAGGAAGATCAAGG - Intronic
993306850 5:86284878-86284900 CAGGTAACTGAGAAAAATCAGGG + Intergenic
994061431 5:95482346-95482368 CTTGAAACTGAGAGATAACATGG + Intronic
994547701 5:101187588-101187610 CTTTTATCTGAGAAGGAACATGG + Intergenic
994582487 5:101662529-101662551 CTGATAACTGAAAAATACAATGG + Intergenic
995165130 5:109030889-109030911 TTCCCAACTGAGAAATAACAAGG - Intronic
995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG + Intronic
997008905 5:129853412-129853434 ATATTATCTGAGAAAGAACAAGG + Intergenic
997938844 5:138138470-138138492 ATGTAAAATGAGAAATAAAATGG - Intronic
1000413189 5:160955761-160955783 CTTTTAACTGAGACATAAACAGG - Intergenic
1003580535 6:7336160-7336182 TTGTCATCAGAGAAATAACATGG + Intronic
1004055655 6:12135600-12135622 ATATAAACTGATAAATAACAAGG + Intronic
1004144547 6:13052950-13052972 CTGTCTACTGAGAAAAAAGAAGG - Intronic
1004926042 6:20416035-20416057 CTGTTAAATGAGGAAAATCATGG + Intronic
1005506861 6:26476859-26476881 CTGTCACCTTAGAAATAACCTGG - Intergenic
1006328638 6:33373339-33373361 TTGTTACCTGAAAAAAAACAGGG - Intergenic
1007334647 6:41145749-41145771 GTGTTAACGAAGAAATTACAAGG - Intergenic
1008455215 6:51702811-51702833 CTGTTAAAAGAGAAAGAAAAAGG + Intronic
1008988457 6:57574785-57574807 CTGTGAAATGAAAAATTACAGGG + Intronic
1009177066 6:60473375-60473397 CTGTGAAATGAAAAATTACAGGG + Intergenic
1009597970 6:65760782-65760804 CTGTTAACTGAGAGAGAAGAAGG - Intergenic
1009836328 6:69005933-69005955 CTGGCAACTGAAAACTAACAAGG - Intronic
1010131319 6:72497120-72497142 GTGTGAACTTAGAGATAACAAGG - Intergenic
1010659094 6:78548077-78548099 GTGTTAACTTAAAAATTACAAGG - Intergenic
1010685610 6:78851765-78851787 TTGTTCACTCAGAAATATCAGGG - Intergenic
1014756035 6:125302424-125302446 CTGTCAACTGAAGAATAACGAGG - Intergenic
1014945391 6:127491513-127491535 CTGTTAAGTGTGCAATAACATGG - Intronic
1015006206 6:128285020-128285042 ATGTAAACTGAGAAATAATAAGG - Intronic
1017320316 6:153084442-153084464 CTGTTAACAGAGACATAGGATGG + Intronic
1017681899 6:156872731-156872753 TAGGTATCTGAGAAATAACAAGG + Intronic
1018158836 6:161016996-161017018 TTATTAACATAGAAATAACAAGG - Intronic
1021173849 7:17427202-17427224 CAGTTAACTGAGAAACAGCATGG - Intergenic
1022217185 7:28274980-28275002 CTGTTACCTGAGAAATTAAGTGG - Intergenic
1023238646 7:38117979-38118001 CTGTGAACAGATCAATAACAAGG - Intergenic
1025858146 7:65302230-65302252 CTTTTAAATGAGAAAATACAAGG + Intergenic
1026127589 7:67593157-67593179 CTGTAAAATGGGAAATAACAAGG + Intergenic
1026410648 7:70118476-70118498 TTGTTACCTTAGAAACAACAAGG + Intronic
1026850532 7:73720471-73720493 CTGTGAACTGAGAAATCCTAGGG - Intergenic
1028286313 7:89006723-89006745 CTGTTAACAGAGACTTCACAAGG + Intronic
1029070711 7:97894549-97894571 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1029143782 7:98431096-98431118 CTGTTTACTGTGCAACAACAGGG - Intergenic
1030147823 7:106374312-106374334 CTGTTAACAGAGAAGTAAATTGG - Intergenic
1031153654 7:118083915-118083937 CTGTTTACTGATGAAAAACACGG + Intergenic
1031192915 7:118577548-118577570 CTCTTAAATGACAAAAAACATGG + Intergenic
1032238847 7:130145807-130145829 CTATAAGCTGAGAAATACCAAGG + Intergenic
1032894297 7:136233821-136233843 CTATTAATTGAAAAATAACGTGG + Intergenic
1033978872 7:147139143-147139165 CTGTTAACTGAGAAATATACTGG - Intronic
1034373719 7:150625600-150625622 CTGTTCACTTAGAAATAAAATGG + Exonic
1034599217 7:152232586-152232608 CTGATAACAGGGAAATAAGAAGG + Intronic
1036247857 8:7135227-7135249 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1036252956 8:7179146-7179168 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1036364540 8:8108328-8108350 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1036894007 8:12616877-12616899 CTGTTATCAAAGAAATAAAAAGG + Intergenic
1037145275 8:15564267-15564289 ATGTTAACTCAAAAACAACATGG - Intronic
1037897938 8:22670584-22670606 CTGTTTCCTGAGGAACAACATGG - Intergenic
1039510135 8:38085262-38085284 CTTTTAACTGAGATATAAGTGGG + Intergenic
1039797876 8:40930886-40930908 CTTTGAGCAGAGAAATAACATGG - Intergenic
1041596079 8:59654574-59654596 CTGATACCAGAGAAATAAAAAGG + Intergenic
1043888000 8:85624510-85624532 CTCTTAACTTAGTAAAAACAAGG + Intergenic
1045831470 8:106466476-106466498 CCTTTAACTTAGAAATCACATGG + Intronic
1046051321 8:109025961-109025983 ATGTTAACTGAGAAATGAGATGG + Intergenic
1046356943 8:113099515-113099537 TTGTTTACAGAGAAATAATAGGG + Intronic
1047884691 8:129236302-129236324 CTGCTTTCTCAGAAATAACAAGG + Intergenic
1048220710 8:132538820-132538842 ATGATAACTTAGAAATAATACGG + Intergenic
1049481202 8:142823995-142824017 CAGTTCACTGAGAAATGAAAGGG - Intergenic
1050090459 9:2013439-2013461 CTATTAACTGAGAAATATATAGG - Intergenic
1051844750 9:21438854-21438876 CATTTAAATGAGAAAGAACAAGG - Intronic
1052396682 9:27947478-27947500 CTAAGAACTGAGAAAAAACAAGG - Intergenic
1053339428 9:37310549-37310571 CTGAAAACTGAGACATTACAAGG + Intronic
1053952353 9:43408222-43408244 CTGTTAGTTGAGAAAACACATGG - Intergenic
1053957001 9:43488895-43488917 CTGTTAATTGAGAACACACATGG - Intergenic
1054012335 9:44449676-44449698 CTGTTAGCTGAGAACACACATGG - Intergenic
1054017010 9:44530324-44530346 CTGTTAGTTGAGAAAACACATGG - Intergenic
1054031575 9:44780366-44780388 CTGTTAATTGAGAACACACATGG - Intergenic
1054065463 9:45358033-45358055 CTGTTAGTTGAGAAAACACATGG - Intergenic
1054943465 9:70769603-70769625 TTTTTAATTGACAAATAACATGG - Intronic
1054951098 9:70852665-70852687 ATTTTAATTGAGAAATAATATGG - Intronic
1056981456 9:91315578-91315600 CTGTCAACTGAAGAATGACAAGG - Intronic
1057122996 9:92594070-92594092 CTAATAACAGAGGAATAACAGGG + Intronic
1057575312 9:96237805-96237827 CTGTTATCTAAGAAATTAAAAGG + Intronic
1061228011 9:129292019-129292041 CAGTTAACTTAGAGTTAACATGG + Intergenic
1061639781 9:131943729-131943751 CTGTTAACAGGGTAATAACTTGG + Intronic
1203597452 Un_KI270747v1:162842-162864 CTGTTATTTGAGAAAACACATGG - Intergenic
1186094510 X:6085069-6085091 CCCTTAGCTGAGAAACAACAGGG + Intronic
1186126612 X:6421169-6421191 CTGTTTACTGAGACAGAAAATGG - Intergenic
1186233973 X:7486771-7486793 TTGTAAACTGAGAAATAACTGGG - Intergenic
1186327292 X:8493606-8493628 CTATTTACTGAGAAATTACCTGG + Intergenic
1187810750 X:23174162-23174184 CTGTTAATTTAGAAAGAAAATGG + Intergenic
1187971734 X:24665591-24665613 CAGTTAATTGAAAAATAAAATGG - Intronic
1188369643 X:29352885-29352907 CTCCTAAGTGAGAAATAACAGGG - Intronic
1188738352 X:33745992-33746014 CTGTTATCTAAAAAATAATAGGG - Intergenic
1189096475 X:38145549-38145571 CTGTTAACTGTGGAATTGCAAGG + Intronic
1189461127 X:41243814-41243836 CTGTTAGCTTAGAATTAAAATGG + Intergenic
1189552879 X:42111831-42111853 TTTTTAACTGAGAAAAATCATGG + Intergenic
1190782088 X:53607341-53607363 CTTTTCAATGAGAAATAACATGG + Intronic
1192924227 X:75738630-75738652 CTGTTAACAGAGAATGAAAAGGG - Intergenic
1195262837 X:103150591-103150613 TTGTTAACTGAAAAAAAGCAAGG + Intergenic
1197131338 X:123009007-123009029 CTGTTTATTAAGGAATAACAAGG + Intergenic
1197452608 X:126638781-126638803 ATGATAACAGAGCAATAACAGGG - Intergenic
1198731821 X:139739189-139739211 CAGTTAACTGAGCCATAACAGGG + Intronic
1199488274 X:148371716-148371738 CAGTTAACTGAAAAATAGAAGGG - Intergenic
1199782807 X:151078553-151078575 CTGTTTACTCAGAAGTAAAATGG - Intergenic
1201329375 Y:12801310-12801332 ATGTTAACTGGGTAAGAACAAGG + Intronic
1201538784 Y:15083707-15083729 CTGTCAACAGAGAACGAACAAGG - Intergenic
1201934416 Y:19392110-19392132 CTGAGAACTGAAAAAAAACAAGG - Intergenic
1202079488 Y:21070015-21070037 CTGTTAACTAAAATATAACCTGG - Intergenic