ID: 995656238

View in Genome Browser
Species Human (GRCh38)
Location 5:114429587-114429609
Sequence GAAGCTTTTAAGTTTAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 1, 2: 7, 3: 50, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995656235_995656238 13 Left 995656235 5:114429551-114429573 CCCAGTCTGTGGCTTGTACTTTG 0: 1
1: 0
2: 22
3: 255
4: 1206
Right 995656238 5:114429587-114429609 GAAGCTTTTAAGTTTAATGAAGG 0: 1
1: 1
2: 7
3: 50
4: 287
995656236_995656238 12 Left 995656236 5:114429552-114429574 CCAGTCTGTGGCTTGTACTTTGT 0: 1
1: 0
2: 3
3: 60
4: 688
Right 995656238 5:114429587-114429609 GAAGCTTTTAAGTTTAATGAAGG 0: 1
1: 1
2: 7
3: 50
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995656238 Original CRISPR GAAGCTTTTAAGTTTAATGA AGG Intronic
901149873 1:7094158-7094180 GAAGCTTTCAAGTGTAAACATGG - Intronic
902608806 1:17585142-17585164 GTAGCTCATAAGTTTAATTAGGG - Intronic
905500525 1:38432949-38432971 GAAGATTTTAAGAGTAATGATGG - Intergenic
906266943 1:44438940-44438962 TAAGCTTTTAAGAGTAGTGATGG - Intronic
907142428 1:52200489-52200511 GAAATTTTTAATTTTAGTGAAGG + Intronic
908823548 1:68112755-68112777 GAAGATTTTAAGTTCCTTGAAGG + Intronic
909243938 1:73253396-73253418 GAAGCAATTAAGGTGAATGAGGG + Intergenic
910129870 1:83890948-83890970 GATTCTTTTTAATTTAATGAAGG - Intronic
910734050 1:90432610-90432632 AAAGCTCTTTAGTTTAATTAAGG - Intergenic
910811337 1:91239875-91239897 TATGCTTTTAGGTTTAAAGAAGG - Intergenic
910959695 1:92748513-92748535 GAAGCCATTAAGTTTCATGGTGG + Intronic
911737858 1:101357344-101357366 GTCTCTTTTAAGTTCAATGAAGG + Intergenic
912957082 1:114162501-114162523 GAAACTCTTTAGTTTAATTAGGG - Intergenic
912997472 1:114545618-114545640 TAGGCTTTTCAGTTTAATGGAGG - Intergenic
913417774 1:118630752-118630774 GAAGCTTTTTAGTTTAATTAAGG + Intergenic
913699791 1:121363109-121363131 GAAGCTTTTCATTTTATAGAAGG + Intronic
914137750 1:144916927-144916949 GAAGCTTTTCATTTTATAGAAGG - Intronic
915826261 1:159080805-159080827 GAAGATTTAAAGTTTGTTGAAGG - Intronic
917934664 1:179853761-179853783 TAAGCTTTTAAGTTAAAATATGG - Intronic
918598517 1:186323229-186323251 TTAACTTTTAAGTTTAATGAAGG - Intronic
918721388 1:187856760-187856782 AAAGCTCTTTAGTTTAATTAAGG + Intergenic
918905608 1:190488560-190488582 GAAGATTTTAATTTTAATGCAGG - Intergenic
919055469 1:192564833-192564855 GAAGTTATTAAGTAGAATGAGGG + Intergenic
919267158 1:195284392-195284414 GAAGCTGTTTAGTTTAGTTAAGG + Intergenic
920487204 1:206381818-206381840 GAAGCTTTTCATTTTATAGAAGG + Intronic
921226012 1:213020002-213020024 GAAATTATTAAGCTTAATGAAGG + Intergenic
921434841 1:215106574-215106596 GAAGCTCTTTAGTTTAATTATGG + Intronic
921579112 1:216874465-216874487 TAAGTTTTTAAGTTAGATGAGGG - Intronic
921788233 1:219258773-219258795 GAAGCTTTTTAGTTTAATTAAGG - Intergenic
924686434 1:246295729-246295751 AAATCTTTTAATTTTATTGATGG - Intronic
1063757856 10:9035789-9035811 GAAGATATTTGGTTTAATGAAGG - Intergenic
1063993011 10:11586791-11586813 GAAGATTTTAAGTTTAGTTTAGG - Intronic
1064931440 10:20632753-20632775 GATGCTTTTAAGTATATTTATGG + Intergenic
1065721803 10:28634926-28634948 GAAGCTTGTGGGTTTCATGATGG - Intergenic
1067442427 10:46316542-46316564 GAAGCTCTGATGTTTAGTGATGG + Intronic
1067963545 10:50883463-50883485 GAAACTTTTAAAATTAATTACGG - Intronic
1068259986 10:54567321-54567343 GAAGTTTTTAATTTCAATGAAGG + Intronic
1068544691 10:58332719-58332741 GAAGATTTTAAGTTTATGGAAGG + Intergenic
1068557116 10:58471092-58471114 GAAGCCTTTTATTATAATGAGGG + Intergenic
1069215909 10:65820728-65820750 GATCCTTTTAAATTTATTGAGGG + Intergenic
1070182987 10:74032301-74032323 CAAGCTTTTAATTTTGATAAAGG - Intronic
1071576844 10:86733537-86733559 GAAGGTTTTAAGTTTGTTCAAGG - Exonic
1071745295 10:88411962-88411984 GAAGCTTTTGTGGTTAATGTGGG + Intronic
1072370281 10:94759112-94759134 GAAGTTTTAAATTTTAATAAAGG - Intronic
1072431238 10:95372797-95372819 GATTGTTGTAAGTTTAATGAGGG + Intronic
1072803124 10:98407221-98407243 GCAGCTCTCAAGTTCAATGAGGG + Intronic
1072851468 10:98897848-98897870 GAAGTTTTCAATTTTAATAAAGG - Intronic
1073047392 10:100647783-100647805 GAATGTTTTAAGAATAATGATGG - Intergenic
1073170940 10:101508011-101508033 GAAGCTATAAAGTTGCATGAGGG + Intronic
1073669460 10:105571280-105571302 GAAGCTCTTTAGTTTAATTAGGG - Intergenic
1078817304 11:14838646-14838668 GCAGGATTTAAGTTTAATTATGG - Intronic
1080057493 11:27921679-27921701 AAAGCTTTTATGACTAATGATGG - Intergenic
1080244115 11:30160200-30160222 GAAGTTTTAAAGATTAATGGAGG - Intergenic
1080865675 11:36192752-36192774 GAACCTTTTAGGGTGAATGATGG + Intronic
1085819452 11:79776659-79776681 GACTCTTCAAAGTTTAATGATGG - Intergenic
1086308726 11:85511646-85511668 GAAACATTTAATCTTAATGAAGG - Intronic
1086729235 11:90227618-90227640 GGAGCTTTAAGATTTAATGACGG - Intergenic
1088267992 11:108005888-108005910 AAAGCTTTTAAGTTGTAAGAGGG - Intergenic
1088739314 11:112753839-112753861 GAGGCCTTTCAGTCTAATGAAGG + Intergenic
1089020293 11:115206830-115206852 GCAGCTTTTAAGGCTAATGGTGG + Intronic
1089076174 11:115740664-115740686 AAAGCTTTTAAGTTAAGTGCTGG + Intergenic
1089162368 11:116448736-116448758 GGAGTTTTTAATTTTGATGAAGG - Intergenic
1090577368 11:128120298-128120320 AAAGTTTTTAAGTTTGATAAAGG + Intergenic
1091877380 12:3947126-3947148 AAAGATTTTGAGTTTTATGATGG - Intergenic
1092030921 12:5284329-5284351 AAAACATTTAAGTTTAGTGAAGG + Intergenic
1092334648 12:7620031-7620053 TCAGTTTTTAAGCTTAATGAAGG + Intergenic
1093163372 12:15776250-15776272 GAAGCTTTTAAATGTAATTTTGG + Intronic
1093296518 12:17398645-17398667 GAATATTTTCAGTTGAATGATGG + Intergenic
1093840502 12:23893556-23893578 GATGATTTTAAGTATACTGAAGG - Intronic
1094403548 12:30089006-30089028 GAAGCTTTATACTTTAGTGAAGG + Intergenic
1095274152 12:40259846-40259868 GGAGCTTTTATTTTTAAGGAGGG + Intronic
1095723702 12:45428802-45428824 CTAGTTTTTAAGTTTAATGGAGG + Intronic
1098488122 12:71045383-71045405 CAAGGTTTTAAGTTCCATGAGGG + Intergenic
1099518414 12:83628179-83628201 GAAGCTTGTAAATTTATTTAAGG + Intergenic
1100285689 12:93164467-93164489 GATGCTTTGTGGTTTAATGAAGG + Intergenic
1102663825 12:114552500-114552522 AAAGCTGTTTAGTGTAATGAAGG + Intergenic
1102715328 12:114966475-114966497 GAAGCTTCTTAGTTTGATGTAGG + Intergenic
1103967826 12:124651439-124651461 GAAGCTATTAAGTTTTAAGCAGG - Intergenic
1105613745 13:21993006-21993028 GAAGCTTTTTAGTTTGATGTAGG + Intergenic
1105951479 13:25233030-25233052 GAGGCTTTATAGTTTAATGGGGG - Intergenic
1105954464 13:25267497-25267519 TAATCTTTTAAGTCTATTGATGG - Intronic
1106423053 13:29599604-29599626 GAAGGTTTTAACTTTAATGAAGG - Intergenic
1106789662 13:33141784-33141806 GAAGCATTTGAGTCTAATAAGGG + Intronic
1107555167 13:41511010-41511032 GAAGTTTTTAATTTTGATGAAGG - Intergenic
1107774604 13:43824559-43824581 GAAGGTCTTTAGTTTAATTAAGG - Intronic
1108111436 13:47077792-47077814 GAAGCTCTTTGGTTTAATTAGGG - Intergenic
1108137202 13:47378492-47378514 GAAACATTTAATTTTGATGAAGG - Intergenic
1109135154 13:58640084-58640106 AATGCATTTAAGTTTTATGATGG + Intergenic
1109244702 13:59939609-59939631 GAGGCTTTTAAGCATAAGGATGG - Intronic
1110007819 13:70294266-70294288 GGAACTTTAAGGTTTAATGACGG + Intergenic
1110230220 13:73160191-73160213 GAAGCTCTTTAATTTAATTAGGG - Intergenic
1111039997 13:82735524-82735546 GAAGCTCTTTAGTTTAATTAAGG + Intergenic
1111666623 13:91277626-91277648 GAACATTTTAAGTTAAACGAGGG + Intergenic
1111688393 13:91529227-91529249 GAAGCTCTTAATTTTTATGAAGG - Intronic
1111871027 13:93832406-93832428 GAAGCTTTTGATTTTGTTGAAGG + Intronic
1112074795 13:95900279-95900301 TAAGCTATTAAGTTTTATTAGGG + Intronic
1112340088 13:98545675-98545697 GAAGATTTTAAGTTTATTCCTGG + Intronic
1112878723 13:104079857-104079879 GAAGTTTTTAATTTCAGTGAAGG - Intergenic
1112983893 13:105422384-105422406 GCAGTTTTTTAGTTTAATGTGGG - Intergenic
1113027888 13:105961204-105961226 GAAGTTTTAAAGTTTAAAAAGGG + Intergenic
1115860900 14:37685017-37685039 GAAGCTCGTTAGTATAATGAAGG + Intronic
1116006999 14:39304279-39304301 GAAGCATTTAACTTTAAAGAAGG - Exonic
1116051339 14:39807191-39807213 GGAGATTTTAAGTCTACTGATGG + Intergenic
1116629792 14:47315572-47315594 GAAGCTGTTGAGTTTCATTAAGG - Intronic
1117283087 14:54259585-54259607 GAAGATTGTAATTATAATGAGGG - Intergenic
1118177571 14:63456960-63456982 CAAGTTTTTTAATTTAATGAAGG - Intronic
1119489528 14:75018959-75018981 GGGGCCATTAAGTTTAATGATGG - Exonic
1120918169 14:89728875-89728897 GAAGCTTTTGAATATAATGGTGG - Intergenic
1120953628 14:90062863-90062885 GGAGATTTTCAGTCTAATGAAGG + Intronic
1121375855 14:93410358-93410380 GTGCCTTTCAAGTTTAATGAGGG - Intronic
1202933639 14_KI270725v1_random:63451-63473 TAAAATTTTAAGTGTAATGATGG - Intergenic
1123929966 15:25162554-25162576 GAAGCCTCTAAGCTTCATGAGGG - Intergenic
1126564472 15:50080741-50080763 GAAATTTTTAAGTTCAATTAAGG + Intronic
1127139111 15:55955774-55955796 GTAGTTTTTAAGTGTCATGATGG - Intronic
1128118333 15:65127147-65127169 AAAGTTTTTAAGTGAAATGATGG - Intronic
1129338691 15:74870907-74870929 GCAGCTTTTAAGTTTCCTGCAGG - Intronic
1131949203 15:97662448-97662470 GAAGCTTTTACATTTGATGAAGG - Intergenic
1133425726 16:5687389-5687411 GAAGCTAAAAAGTTTAAGGACGG - Intergenic
1133824341 16:9263674-9263696 GAAGCTTTTTACTTTATTGAGGG + Intergenic
1133862383 16:9608417-9608439 GTAGACTGTAAGTTTAATGATGG - Intergenic
1136614823 16:31392105-31392127 GGAACTTTTATGTTTAATCATGG + Intergenic
1137711415 16:50569467-50569489 GAAGCTTTTAAGAACAAGGAGGG - Intronic
1138059609 16:53876439-53876461 AAAGTTTTTAACTTTGATGAAGG - Intronic
1138149501 16:54643050-54643072 GGAGATTATAATTTTAATGAGGG - Intergenic
1138954879 16:61959138-61959160 GAAGTATTTAAGTTAGATGAAGG - Intronic
1139735034 16:68980268-68980290 GAAGTTTTTAATGTCAATGAAGG + Intronic
1140071253 16:71652037-71652059 AGAGCTTTTAGTTTTAATGAAGG - Intronic
1141073349 16:80978772-80978794 GAAGCTTTTAAGTAGAAAAAGGG - Intronic
1141232305 16:82180387-82180409 TTAGCTTTTAAGTGTGATGATGG - Intergenic
1142617556 17:1145329-1145351 GAAGCTGTTAACTCTAATAAGGG - Intronic
1144324725 17:14168187-14168209 GGAGCTTTAAGATTTAATGATGG - Intronic
1147718564 17:42523795-42523817 AAAGCTTTTAATTTTGCTGAAGG - Intergenic
1149367471 17:55960166-55960188 AAGGCTTTTAATTTTAATGATGG + Intergenic
1150509386 17:65733714-65733736 GAACCTTTTATGATTTATGAGGG + Intronic
1150862801 17:68818537-68818559 GTAGCTTTTCAGTTTTAAGATGG - Intergenic
1155143379 18:23063633-23063655 GAAGCAATTATGATTAATGAGGG - Intergenic
1155797888 18:30063458-30063480 AAATCTTTTAATTTTAATAAAGG - Intergenic
1156080211 18:33325519-33325541 GAAATTTTTAAATTAAATGAAGG - Intronic
1156558741 18:38097492-38097514 TTAGCCTTTACGTTTAATGATGG - Intergenic
1156655380 18:39278965-39278987 CTAGATTTTAAGTTTACTGAAGG + Intergenic
1157250870 18:46095173-46095195 TAAGCTTGTAAGTTTTATAAAGG - Intronic
1158212656 18:55068324-55068346 TAAGCTTCTAAGTTTAGGGAGGG + Intergenic
1158376497 18:56875733-56875755 GTAGCCCTTAAGTTCAATGAGGG + Intronic
1158997854 18:62941649-62941671 AAAGCTTTTAGGTTTCTTGAGGG + Intronic
1159007606 18:63026350-63026372 GAAACTTTTAAGTTGATTCAAGG - Intergenic
1159165507 18:64693900-64693922 GACGCCTTTAACTTTAATCAGGG - Intergenic
1159763945 18:72462687-72462709 TAAGCTTTTAAGGTTGATGGAGG + Intergenic
1161924750 19:7292577-7292599 GAAGCTCTTAAATGTATTGATGG - Intronic
1162195886 19:8984398-8984420 GAAGCTCTTTAGTTTAATTAAGG + Intergenic
1162488711 19:10978305-10978327 GAAGCTCTTAATTCTAATGAAGG - Intronic
1164396678 19:27870806-27870828 GAAGATTTAAATTATAATGAAGG - Intergenic
1164944329 19:32280620-32280642 GACGCTCTTTAGTTTAATGGAGG - Intergenic
1166580690 19:43895975-43895997 GATGTTCTTAATTTTAATGAAGG + Intronic
925061853 2:897490-897512 AGAGCTTTAAAATTTAATGACGG + Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927225603 2:20763013-20763035 GAATCTTTTAAGTTCTAAGATGG - Intronic
928998031 2:37316672-37316694 GATACTTTTAAGTTTTATCAAGG + Exonic
930536045 2:52647880-52647902 GGAGCTTTAAGATTTAATGATGG - Intergenic
930827468 2:55708920-55708942 AAAGCTTTTGATTTTAATGAGGG - Intergenic
930927516 2:56837375-56837397 GAAACTTTTTAGTTTAATTCAGG - Intergenic
931398408 2:61908523-61908545 GTTGCTTTTAAGTTAAATAAAGG - Intronic
932650938 2:73555607-73555629 AAAGTTTTTCAGTTTAATAATGG - Intronic
932980254 2:76655122-76655144 GCAGTTTTTTATTTTAATGAAGG + Intergenic
933007165 2:77009932-77009954 TGAAATTTTAAGTTTAATGATGG - Intronic
936722174 2:115265670-115265692 TAAGATTTTAGGTTTAATGGTGG + Intronic
937561220 2:123226391-123226413 GAAGCTTTTTAGTTTAGTTAGGG + Intergenic
938831956 2:135059958-135059980 GAAGATTTTAACTTATATGAAGG + Intronic
939565122 2:143778018-143778040 AAAGCTTTTGTGTTTACTGAAGG - Intergenic
940903021 2:159144159-159144181 GAAGACTTTAAGTTGAGTGATGG + Intronic
941322920 2:164077713-164077735 GGAATTTTTAAGTTTAATGAGGG - Intergenic
941865269 2:170327715-170327737 GAATCTTTCACATTTAATGACGG + Intronic
942131083 2:172880144-172880166 CAACATTTTATGTTTAATGATGG - Intronic
942253237 2:174065559-174065581 GAAGTTTTTAATTCTAATGCAGG + Intergenic
942507145 2:176655098-176655120 GAAGCTTATCAGTTGAATGTGGG + Intergenic
942575776 2:177361990-177362012 GAAGGATTTAAGATTAAGGAAGG - Intronic
942818773 2:180085050-180085072 GAAGCTTTTAGGATTATTTATGG + Intergenic
943367541 2:186980391-186980413 TAAGCCTGTAAGTTTAATAAAGG - Intergenic
944980573 2:205115032-205115054 CAGGCTCTTTAGTTTAATGAAGG + Intronic
945356358 2:208843874-208843896 GGAGCTTTAAGATTTAATGATGG + Intronic
1169535216 20:6531758-6531780 GAATCTTTTAAGTCCCATGAGGG - Intergenic
1170337017 20:15281544-15281566 GGAACTTTGAGGTTTAATGAGGG - Intronic
1174232668 20:49059376-49059398 TCAGCTGTTAAGTTAAATGAGGG + Intronic
1174845606 20:53940295-53940317 GAAGCACTTAAGTTCAGTGAGGG + Intronic
1177346361 21:19877250-19877272 GAAGCTCTTTAGTTTAATTAGGG - Intergenic
1177809122 21:25905910-25905932 GAAGTTTTTAGGATTAATAATGG + Intronic
1178227246 21:30736388-30736410 GAAGATTTTCACTTTAATCAAGG + Intergenic
1178353226 21:31888115-31888137 GACTCTCTTAAGTTTAATGTAGG + Intronic
1179031377 21:37722939-37722961 GAGGCTCTTTAGTTTAATTAGGG - Intronic
1182251175 22:29001974-29001996 AAAGCTTTTAAGTTAATAGAGGG + Intronic
1182900220 22:33892072-33892094 GAAGCTTTGTAGTTTTGTGAGGG - Intronic
1182920988 22:34078700-34078722 GAAGCTTTTTAGGTTAATGTTGG - Intergenic
951008442 3:17647281-17647303 TAAGCTTGTAAGCTTCATGAGGG - Intronic
951256384 3:20454207-20454229 GAAGTTTTTATGTTTAATCTTGG - Intergenic
951636274 3:24781766-24781788 GTAGCTTTTATGTTTACAGATGG + Intergenic
953222262 3:40983090-40983112 TCAGCTTTTAATTTTAATGATGG - Intergenic
954126804 3:48536107-48536129 GAAGATTCTAGGTTGAATGAAGG + Intronic
956133563 3:66076908-66076930 GAAGCTTTTAAGCTTAGCCAGGG - Intergenic
956944471 3:74203986-74204008 GCAGCTTTTAAGTATTAAGATGG + Intergenic
958605968 3:96358915-96358937 GAAGCTCTTTAGTTTAATTAGGG - Intergenic
958639662 3:96789401-96789423 GAAGCTTTTTAGCTTAATGCAGG + Intergenic
959071940 3:101710016-101710038 GAAGATTTTATGTTTTATAAAGG - Intergenic
959677469 3:109052679-109052701 GAAGATTTTAAGTTGACTCAAGG + Intronic
959900962 3:111661640-111661662 GGAGCTTTAAGATTTAATGATGG - Intronic
960436214 3:117629843-117629865 GAATTTATTAAGTTAAATGATGG + Intergenic
961089731 3:124100368-124100390 GAAGCTTTTTAGTTTCAACAAGG + Intronic
963016243 3:140826925-140826947 GTAATTTTTAATTTTAATGATGG - Intergenic
963662621 3:148146400-148146422 GAATCTCTTAATTTTAATAAAGG + Intergenic
963770908 3:149385126-149385148 GGAGCTGTAAAGTTAAATGACGG - Intergenic
964045493 3:152319926-152319948 GAAGCTATTCATTTTCATGAAGG - Intronic
964774605 3:160262085-160262107 AACGCTTGTAAGTTTATTGATGG + Intronic
968260341 3:197317235-197317257 GAACTTTTTATGTTTACTGAGGG - Intergenic
969473474 4:7404842-7404864 GAAGCTTTTCAGTTTAATTAAGG + Intronic
970794788 4:19898426-19898448 GAATCTTTTAAGTCAAATGTTGG + Intergenic
973104948 4:46323977-46323999 GAGGCTTTTATTTTTAAAGATGG - Intronic
974764968 4:66332246-66332268 TAAGTTTTAAAGGTTAATGATGG + Intergenic
974924107 4:68276604-68276626 GAAGTTCTTAATTTTAATGAAGG + Intergenic
974980919 4:68956234-68956256 GGAGCTTTAAGATTTAATGAGGG + Intergenic
975563811 4:75732926-75732948 GAATGTTTTAAGCTTCATGAAGG + Intronic
975938264 4:79608476-79608498 GAAGCTGTTTAGTTTAATTAGGG + Intergenic
976036198 4:80824189-80824211 GGAACTTTTAAGTCTATTGAAGG + Intronic
976987991 4:91326863-91326885 GAAGCTTTAAGATTTAATGGAGG - Intronic
977040572 4:92012257-92012279 GAAGCTGTTTAGTTTAATTAGGG + Intergenic
977702435 4:100035760-100035782 GGAACTTTAAGGTTTAATGAGGG - Intergenic
978742864 4:112157936-112157958 TAAGCTTTTAAATTTAAAGAAGG + Intronic
978847421 4:113290739-113290761 CAAGATTTCAAGTTTGATGAAGG - Intronic
979553681 4:122020571-122020593 GAAGCTTTTTAGCTTAATTAAGG - Intergenic
980305597 4:131057191-131057213 GAAGCTTTTTAGTTTAAGTAAGG + Intergenic
982678673 4:158404580-158404602 GATTCTTTAAAGTTTGATGAAGG - Intronic
983089197 4:163484429-163484451 GAAGCTTTGAAGTCGAAAGAAGG - Intergenic
984714083 4:182910532-182910554 GAAGATTTTTATTTTCATGAGGG - Intronic
985839150 5:2292680-2292702 GAAGCTCTTTAATTTAATTAGGG - Intergenic
986109503 5:4698109-4698131 GAAGTTTTTAATTTGGATGAAGG - Intergenic
986913947 5:12592384-12592406 GAAGGTTTTGACTTTCATGAAGG - Intergenic
987793924 5:22604634-22604656 GGTGCTTTTATCTTTAATGAAGG - Intronic
987918499 5:24248320-24248342 GCAACTTTAAGGTTTAATGACGG - Intergenic
988057374 5:26115873-26115895 AAAAGTTTTAATTTTAATGAAGG - Intergenic
988166259 5:27593655-27593677 GAAACACTTAAGTTTAATGCTGG + Intergenic
988175587 5:27719763-27719785 GAAGCTATTAAAATTAATGGAGG - Intergenic
988213904 5:28246636-28246658 GAAGCTTCTTAGTTTGATGTTGG - Intergenic
988872405 5:35405700-35405722 GAAACTTTTAAGGGTAAAGAGGG - Intergenic
988910951 5:35842887-35842909 AAAGCTTTTAGTTTTGATGAAGG - Intergenic
989951292 5:50300637-50300659 GAAGATTTTAATATGAATGAAGG - Intergenic
991986890 5:72298054-72298076 GATGGTTTTTAGTTTAATTAGGG - Intronic
993324818 5:86520673-86520695 GAAGCTTCTTAGTTTAATTAAGG - Intergenic
993326112 5:86538749-86538771 TATGCTTTAAAGTTTCATGATGG + Intergenic
993858994 5:93111332-93111354 GAAAATTTTAACTTGAATGATGG - Intergenic
993969896 5:94406448-94406470 AAAGCCATTAATTTTAATGAAGG + Intronic
994456438 5:100013828-100013850 GATGCTTTTAAGAATTATGAGGG - Intergenic
994613562 5:102076790-102076812 GCACTTTTTAAGTTTCATGAAGG + Intergenic
995064799 5:107848139-107848161 GAATCTTTTTAGTTTTATAAAGG + Intergenic
995656238 5:114429587-114429609 GAAGCTTTTAAGTTTAATGAAGG + Intronic
995828558 5:116329073-116329095 GAAAATTTAAGGTTTAATGATGG - Intronic
997479584 5:134174583-134174605 GAAGCTTTTAAGTAGATTTAGGG - Intronic
997730561 5:136170086-136170108 AAAGTTTTAAATTTTAATGAAGG + Intronic
1000310256 5:160036570-160036592 GAAGGTTTTGAGTTAAAAGATGG - Intronic
1001981048 5:176037256-176037278 GAAGCTTTTAAGTAGATGGAGGG + Intergenic
1004292063 6:14376513-14376535 ACAGCTTTAAACTTTAATGAGGG + Intergenic
1004872245 6:19918394-19918416 GGAGCTCTTTAGTTTAATTAGGG - Intergenic
1006279860 6:33042635-33042657 AAAGCTCTTTAGTTTAATTAAGG + Intergenic
1008840004 6:55891268-55891290 AAAGCTTTTCAGTTTCATGTAGG + Intergenic
1009440790 6:63675834-63675856 GTCGCTTTTAAGTTTAATGGAGG - Intronic
1009542130 6:64974049-64974071 GAAGCTCATAAATGTAATGATGG - Intronic
1009792451 6:68420481-68420503 GGAGCTTTAAAATTTAATAATGG + Intergenic
1010028085 6:71242967-71242989 GAAGCTTTTTAGTTTAATGAAGG - Intergenic
1010800989 6:80175457-80175479 GAAGCTATAAATTTTAAGGAGGG + Intronic
1010858257 6:80870891-80870913 GAAGCTTTTTAGTTTAATTAAGG - Intergenic
1011103180 6:83747268-83747290 GAAGATTTTAAGTTTAATTAAGG - Intergenic
1011595819 6:89014883-89014905 GAAGCTTTTTTGTTTAATTAGGG + Intergenic
1011849943 6:91614265-91614287 GATGTTTTTAAATGTAATGATGG - Intergenic
1012045085 6:94263501-94263523 GGAACTTTAAGGTTTAATGATGG - Intergenic
1012059348 6:94458434-94458456 GAAGTTGTTAAATTTAATTAAGG + Intergenic
1013682460 6:112540500-112540522 GAAGCTTTTAAGTTTAGAAGAGG + Intergenic
1014467025 6:121768406-121768428 AAAATTTTTAAGTATAATGAAGG + Intergenic
1014861306 6:126470791-126470813 GGAGCTTTAAGATTTAATGATGG + Intergenic
1016903554 6:149126975-149126997 AAAACTTTTAATTTTGATGAAGG - Intergenic
1017688442 6:156937669-156937691 GGAGCTTTTAAGTTGATTGCTGG + Intronic
1020366457 7:7385848-7385870 GAAGCCTTTAAGTATTTTGAAGG - Intronic
1022410133 7:30133609-30133631 GAAGCTTTTTAGTTTAATTAAGG - Intergenic
1024327588 7:48122554-48122576 GAAGCTTTTTAGTTTAAATAAGG + Intergenic
1026518433 7:71093613-71093635 CAAGCTTAGAAGTTTAAGGAAGG + Intergenic
1028704428 7:93822280-93822302 GACGCTTTTAAGTATCATGAAGG + Intronic
1028991311 7:97051484-97051506 GAAACGTTTAAGTTTGCTGAAGG - Intergenic
1029112348 7:98219388-98219410 GAAACTTTTTAGTTTAATTAGGG - Intronic
1029925867 7:104316334-104316356 GAAGATTTTAAGTTTGATGTGGG - Intergenic
1029950690 7:104581491-104581513 GAAGTTTTTAACTTTAAGGCAGG + Intronic
1030664285 7:112257337-112257359 CCAGTTTTTAAGTTTGATGAAGG - Intronic
1032528345 7:132597670-132597692 AAATCTGTTAAGGTTAATGAGGG + Intronic
1033786527 7:144737875-144737897 GAAAATATTAAGTTAAATGAAGG - Intronic
1035348387 7:158224730-158224752 AAAGTTTTTAATTTTGATGAAGG - Intronic
1035623963 8:1057832-1057854 GAAGCTTTGATGTTTAAGGCTGG + Intergenic
1035973577 8:4281615-4281637 AAAGCTTTTAACTTTTATGTTGG + Intronic
1036040047 8:5067600-5067622 GAAGCTTTGAGGTTAACTGAAGG + Intergenic
1039766770 8:40636779-40636801 GAATCTTTAATCTTTAATGAGGG + Intronic
1040793606 8:51264279-51264301 GAAATATTTAATTTTAATGAGGG + Intergenic
1041555794 8:59153845-59153867 GAAAATTTTAATTTTAATGAAGG + Intergenic
1041605884 8:59781838-59781860 GAATCCTCTAAGTTTAATGGGGG - Intergenic
1043107992 8:76139537-76139559 GAAGACTGTAAGTTTCATGAAGG - Intergenic
1044036582 8:87311104-87311126 GAAGCTTTTTAGTTTAATTTAGG - Intronic
1044038104 8:87332049-87332071 GAAGCTCTTTAGTTTAAGGCTGG + Intronic
1044571662 8:93725400-93725422 GTAGCATTTAAGTTTCAGGAAGG + Intronic
1046668789 8:117035387-117035409 GGAGCTTTAAGATTTAATGATGG - Intronic
1046884397 8:119347904-119347926 GAAGTTTTTAATTTTAATAAAGG + Intergenic
1048838134 8:138540909-138540931 GAAGCTTTTTGATTTAATGTTGG - Intergenic
1050665691 9:7934396-7934418 GAAAATTTTAAATTTCATGAAGG + Intergenic
1050712552 9:8482079-8482101 GAAGTTATTAAGATTAAAGATGG - Intronic
1052386251 9:27827061-27827083 AAAGCTTTTAATTTTGATGAAGG + Intergenic
1052654608 9:31339776-31339798 GACGCTTCTAAAATTAATGAGGG - Intergenic
1054892121 9:70262034-70262056 GATGCTGTTTATTTTAATGAGGG + Intronic
1055144350 9:72914885-72914907 GAGGCTTTTAAATACAATGATGG - Intronic
1055361423 9:75495021-75495043 GAAGCTTTTTAGTTTGATGTAGG - Intergenic
1056038168 9:82631341-82631363 TTGGCTTTGAAGTTTAATGAAGG - Intergenic
1056485771 9:87055949-87055971 GAAGCTTTTTATTTTAATGTAGG + Intergenic
1057183728 9:93044074-93044096 GTAGCTTTCAAGTTGAATAATGG + Intergenic
1058176481 9:101741041-101741063 GAAGGTTTAAAGAATAATGAGGG + Intergenic
1058190461 9:101908554-101908576 AAGGCTTTTAATTTTGATGAAGG - Intergenic
1059691984 9:116694190-116694212 GAAGCTTTTCAATTGAAGGAGGG + Intronic
1059843249 9:118242577-118242599 GGAACTTTAAGGTTTAATGACGG - Intergenic
1059924288 9:119192252-119192274 GAAGCTTTTTAGTTTACTATAGG - Intronic
1061097656 9:128468965-128468987 CAAGCTTTTAATTTTGATGTTGG + Intronic
1185630206 X:1511327-1511349 GGAGCTATGAATTTTAATGAAGG - Intronic
1186148053 X:6645497-6645519 GAAGTTTTTAACATTAATGCTGG + Intergenic
1186864776 X:13708728-13708750 GAAGCTTTTGAGATTAACAATGG + Exonic
1187106077 X:16243440-16243462 GAGCCTCATAAGTTTAATGAGGG - Intergenic
1187764014 X:22619547-22619569 GAAGCTCTTTAGTTTAATTAGGG - Intergenic
1188228311 X:27629196-27629218 GAAGCTTTTTAGATTGATGTGGG + Intronic
1189774184 X:44455479-44455501 GAAGCTTCTGAGTGTACTGAGGG + Intergenic
1191017473 X:55825454-55825476 GAAGCTTTTTTGCTTAATTAGGG - Intergenic
1191927771 X:66332968-66332990 GAAGATTTTTAGTTTAATTAAGG + Intergenic
1191962540 X:66719181-66719203 GAAACGTTTAAGTTTGCTGAAGG - Intergenic
1191989868 X:67023131-67023153 GAAGCTTTTTAGTTTGGTGCAGG + Intergenic
1192672831 X:73164477-73164499 GAAGGCTTTTAGTTTAATTAAGG + Intergenic
1193914254 X:87346522-87346544 GAGGCTCTTTAGTTTAATTAGGG + Intergenic
1193986462 X:88247057-88247079 GAAGTTTTTAATTTTATTGATGG + Intergenic
1194024874 X:88739153-88739175 GAAGCTTTAAAACTTAATGTCGG - Intergenic
1194357924 X:92910744-92910766 GAAGCTTTTTAGTTTATTGTAGG - Intergenic
1194560391 X:95412256-95412278 GGAACTTTAAGGTTTAATGACGG + Intergenic
1195510751 X:105712956-105712978 GGAGCTTTAAGATTTAATGATGG - Intronic
1197464352 X:126784564-126784586 GGAACTTTAAGGTTTAATGACGG + Intergenic
1197651222 X:129066912-129066934 GAAGCTTTGTAGTTTAATTTGGG + Intergenic
1198198293 X:134387204-134387226 GAAACTTGGAAGTGTAATGATGG + Intronic
1199237819 X:145510838-145510860 GAAGCTTTAAGTTTCAATGATGG + Intergenic
1199498613 X:148483942-148483964 AAAGCTCTTTAGTTTAATTAAGG - Intergenic
1199964552 X:152808952-152808974 GAAGTTTTTAATTTTGATGTAGG + Intergenic
1200666104 Y:6026353-6026375 GAAGCTTTTTAGTTTATTGTAGG - Intergenic
1201734049 Y:17238163-17238185 GAAGTTTTTAAAGTTAATGAAGG - Intergenic
1202099683 Y:21294349-21294371 GAAACTTTAAGATTTAATGACGG - Intergenic