ID: 995657544

View in Genome Browser
Species Human (GRCh38)
Location 5:114443887-114443909
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995657538_995657544 9 Left 995657538 5:114443855-114443877 CCTAATTTGTCATGTGGCTGGTG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 995657544 5:114443887-114443909 AGTGTCAGGAAAGGTGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr