ID: 995660265

View in Genome Browser
Species Human (GRCh38)
Location 5:114474500-114474522
Sequence TTCCCTGCACACTCTCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995660265_995660267 -9 Left 995660265 5:114474500-114474522 CCTGTATGAGAGTGTGCAGGGAA 0: 1
1: 0
2: 2
3: 10
4: 144
Right 995660267 5:114474514-114474536 TGCAGGGAAAAAGGTCAATGAGG 0: 1
1: 0
2: 2
3: 22
4: 276
995660265_995660269 9 Left 995660265 5:114474500-114474522 CCTGTATGAGAGTGTGCAGGGAA 0: 1
1: 0
2: 2
3: 10
4: 144
Right 995660269 5:114474532-114474554 TGAGGAGCTGAATAAAGGCTTGG No data
995660265_995660268 4 Left 995660265 5:114474500-114474522 CCTGTATGAGAGTGTGCAGGGAA 0: 1
1: 0
2: 2
3: 10
4: 144
Right 995660268 5:114474527-114474549 GTCAATGAGGAGCTGAATAAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
995660265_995660270 10 Left 995660265 5:114474500-114474522 CCTGTATGAGAGTGTGCAGGGAA 0: 1
1: 0
2: 2
3: 10
4: 144
Right 995660270 5:114474533-114474555 GAGGAGCTGAATAAAGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995660265 Original CRISPR TTCCCTGCACACTCTCATAC AGG (reversed) Intronic
901842983 1:11965398-11965420 TCCCCTGCACGCTCCCAGACGGG - Intronic
906182217 1:43831762-43831784 TTCCCTGCACTCTCTGACACTGG - Intronic
907700718 1:56785357-56785379 GTCCCTTCACACTGTCATACTGG + Intronic
908069637 1:60444122-60444144 TCTGCTGCACACTCTCATTCAGG - Intergenic
911340954 1:96635541-96635563 TTCACTGCACACTCACAAAATGG + Intergenic
912529787 1:110312021-110312043 TTCCCAGCTCTCTCTCATCCTGG - Intergenic
915503587 1:156337959-156337981 TTCTCTGCACAAACTCAAACTGG - Intronic
916025158 1:160827290-160827312 TTCCCTGAACACTCTCAGACAGG + Intronic
916346374 1:163796373-163796395 TTCTCTGCACAGTAACATACAGG + Intergenic
917856676 1:179106762-179106784 TCCCCTGCATACTGACATACTGG - Exonic
1063594716 10:7423830-7423852 TTGCCTGGAGACTCTCAAACTGG + Intergenic
1066492945 10:35911995-35912017 TACCCTCCACCCTCACATACGGG - Intergenic
1073038077 10:100578271-100578293 CTCCCTGCAGACTCTGATAAAGG - Intergenic
1073685698 10:105751353-105751375 TTCACTCCCCACTCTCCTACTGG - Intergenic
1075817072 10:125272640-125272662 TTCCCTGCAGACTCTAACCCTGG - Intergenic
1081597862 11:44471653-44471675 TTCTCTGCCTACTCTCATCCTGG - Intergenic
1083213544 11:61204263-61204285 TTGCCCGCACACTCACATCCAGG - Exonic
1083216427 11:61223099-61223121 TTGCCCGCACACTCACATCCAGG - Exonic
1083219309 11:61241925-61241947 TTGCCCGCACACTCACATCCAGG - Exonic
1084086699 11:66858251-66858273 TGCCCTGCACACCCTCAACCTGG + Exonic
1084196576 11:67526102-67526124 TTCCCTGGCCACTGTCATTCTGG - Intergenic
1088083088 11:105944173-105944195 TTCCCTGCACATTTTCATAATGG + Intronic
1089212303 11:116813837-116813859 CACCCTGCACGCTCTCAGACAGG + Intergenic
1090751776 11:129752555-129752577 TGCTCTGCACACTCTGATAGCGG - Intergenic
1100663986 12:96730275-96730297 TACCCTGAACAGTCTCATAGAGG + Intronic
1100858443 12:98778884-98778906 CTCCCTACCCACTGTCATACTGG + Intronic
1102490204 12:113286021-113286043 TTCTCTGCACACCCTGATCCCGG + Intronic
1104182427 12:126395496-126395518 TTCCCACCACAATCTCATACTGG - Intergenic
1104721855 12:131048841-131048863 TTCCCTGCACAGTCTCGGAGAGG - Intronic
1105909017 13:24843125-24843147 TTTCCTGCTCACTCCCATGCTGG + Intronic
1110967160 13:81713803-81713825 TCCCCTGCAAACTCACACACTGG + Intergenic
1113881722 13:113630724-113630746 ATACCTGGACACCCTCATACAGG - Intronic
1116109144 14:40553372-40553394 TACCAAGCACACTCTCAGACTGG + Intergenic
1117014686 14:51506600-51506622 TTCCCTACACAGTCTCAATCAGG - Intronic
1117098310 14:52319468-52319490 TTCCATGCAGAATTTCATACTGG - Intronic
1117954024 14:61109022-61109044 GTCCCAGCACACTCTCATTCTGG + Intergenic
1120573914 14:86157232-86157254 TTCCCTGCAAATTTTCATTCTGG + Intergenic
1121938142 14:98039778-98039800 CTCCCTCCTGACTCTCATACTGG - Intergenic
1123099870 14:105790441-105790463 TTCCCTCCACACTGCCCTACTGG - Intergenic
1202851416 14_GL000225v1_random:22907-22929 TCCCCTCCACACTCCCAGACCGG + Intergenic
1125073976 15:35591112-35591134 TTCACAGCACACTCTAATGCAGG - Intergenic
1128035986 15:64526950-64526972 TTCCCTTCAAAATCTCATATTGG - Intronic
1132069233 15:98761166-98761188 GCCCCTGCAGACTCTCCTACTGG - Intronic
1134266333 16:12696060-12696082 TACCCTGAAAACTCTCAGACTGG + Intronic
1135539286 16:23317557-23317579 CTCCCTGCTCTCTCTCAGACCGG - Intronic
1137479603 16:48840893-48840915 TTTCCTCCATACTCTCATAATGG - Intergenic
1137862490 16:51860616-51860638 TTCTATCCACACTCTCATCCAGG + Intergenic
1139407224 16:66728819-66728841 TGCCTTGCAGACTCTCCTACAGG - Intronic
1142764241 17:2056664-2056686 TGCCCAGCACACTCTCCTGCGGG - Exonic
1147566163 17:41537581-41537603 TCTCCTGCACACTGTCATTCTGG - Intergenic
1151027614 17:70697214-70697236 TGCCCTGCACACCCTCTGACTGG + Intergenic
1151727119 17:75891762-75891784 TTCCTTGCACACGCACACACAGG + Intronic
1157272813 18:46289699-46289721 TTCCCTTCACACACTCTTTCTGG + Intergenic
1159605403 18:70469403-70469425 CTCCCTGCAAGCTCTCAAACTGG + Intergenic
1160842991 19:1154761-1154783 CTCCCTCCACAGTCTCACACCGG - Intronic
1160958498 19:1706381-1706403 CTCCCTGCACAGACTCATCCTGG + Intergenic
1161157380 19:2739726-2739748 TGGCCTGCACGCTCTCAAACCGG + Intronic
1162210374 19:9086763-9086785 TTCTCTGCACCCTCTCTTCCAGG - Intergenic
1162328818 19:10014341-10014363 TTCCCTGCACACTGGCATTCAGG - Intronic
1164934980 19:32203079-32203101 TTCTCTGGTCACTCTCATCCTGG - Intergenic
1166813168 19:45526334-45526356 TTCCCTGCTCACACCCACACTGG + Exonic
1168633965 19:57980530-57980552 TTTCTTGCACATTCTTATACTGG - Intronic
925088122 2:1128806-1128828 TTCCCTGTGCACTCTCATCCTGG - Intronic
926795842 2:16618172-16618194 TTTCGAGCACACTCTCATCCTGG - Intronic
926909691 2:17840491-17840513 TTCCCTTCACACCATCTTACTGG + Intergenic
931225400 2:60324926-60324948 TTCCCTGCAGACTCAGAGACAGG - Intergenic
932423529 2:71615013-71615035 TTCCCTGCACAATCTCAGACAGG - Intronic
932726928 2:74187505-74187527 TTCCCTGCTTCCCCTCATACTGG + Intergenic
933057730 2:77694134-77694156 TACCCTGCAGACTCTCTTCCAGG - Intergenic
937071696 2:119068412-119068434 TTCACTGCACTCTCTCCCACGGG + Intergenic
937288842 2:120769800-120769822 TTCCCAACACACTCCCAAACAGG - Intronic
939934190 2:148269794-148269816 TTCCCTACATATTCTCATTCTGG + Intronic
945843577 2:214916546-214916568 CTCCCTGCATAATCTCATTCAGG + Intergenic
946044312 2:216808732-216808754 TCACCTGTACATTCTCATACAGG + Intergenic
948097139 2:235344305-235344327 GCACCTGCACACTCTCACACAGG + Intergenic
1169813581 20:9633295-9633317 TTCTCACCACAGTCTCATACAGG - Intronic
1170824638 20:19783375-19783397 TTCTCTGCAAACTCTCATCAGGG + Intergenic
1173036539 20:39416911-39416933 TTCCCTGAACATTCTCTTATTGG + Intergenic
1174957795 20:55119746-55119768 TTCCCTGCACCCTCCCTTCCTGG + Intergenic
1175012505 20:55754022-55754044 TTCCCTACACAGTTTCTTACAGG - Intergenic
1175177464 20:57120833-57120855 CTCCCTGCACACGTTCATCCTGG + Intergenic
1177575698 21:22952191-22952213 TACCCAGCAAACTATCATACAGG - Intergenic
1178782129 21:35613836-35613858 CCCCCTGCCCACTCTCTTACAGG + Intronic
1179097114 21:38325732-38325754 TTCCCTGCACCCTCCCATCTAGG - Intergenic
1179717003 21:43293567-43293589 GTCACAGCACACTCTCACACTGG + Intergenic
1182418297 22:30235626-30235648 TTCCCTGCCCTGTCTCAAACAGG - Intergenic
949348603 3:3100629-3100651 TCCTCTGAACACTCTGATACAGG - Intronic
950690649 3:14653373-14653395 TTCACTGCAGACCCTAATACTGG - Intronic
954703554 3:52465828-52465850 TTCACTGCACAGTCTCTTGCAGG - Intronic
960338458 3:116446125-116446147 TTTCCTGCACTTTCTCTTACAGG + Intronic
962353339 3:134672605-134672627 TTTCTTGAACACTCTCATTCCGG + Intronic
963487738 3:145957346-145957368 TTCACTGCACTCTTTCATACCGG - Intergenic
969388309 4:6871664-6871686 TTACCTTCACACTCTGATGCAGG - Exonic
970141823 4:12991234-12991256 TTGCCTGCACACTCTTAAATTGG - Intergenic
970372172 4:15418873-15418895 TTCCCTACACAGTCTCAGCCAGG - Intronic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
974167731 4:58225408-58225430 TTCGCTGCACACACAAATACAGG - Intergenic
974596221 4:64016959-64016981 TTCCCAGCACATTCTCAAATTGG + Intergenic
975135579 4:70870959-70870981 TTCCCTGTACATTCTCAAAGTGG - Intergenic
977858192 4:101921863-101921885 TTCCATGCACATTCTCTAACTGG + Intronic
978940855 4:114434703-114434725 TTCCATGCACACATTCACACTGG + Intergenic
980391509 4:132153694-132153716 TTCCCTGTTCACTCTAATATTGG + Intergenic
981831894 4:149011328-149011350 TTCTCTGCCCACACTCATTCAGG - Intergenic
985209073 4:187572581-187572603 CTCCCTGCCCACTCTTATCCAGG - Intergenic
985912331 5:2894198-2894220 TTCTTTGAACCCTCTCATACCGG + Intergenic
990358227 5:54991675-54991697 TTCCCAGGACACTCTCATGCAGG - Intronic
993096249 5:83482238-83482260 TTCCCTGGACATTATCATGCTGG - Intronic
995660265 5:114474500-114474522 TTCCCTGCACACTCTCATACAGG - Intronic
996893325 5:128448801-128448823 TTCCTTGAACACTCTTATATTGG + Intronic
997360171 5:133289973-133289995 CTCCCGGCACACTCTCAGAAAGG - Intronic
997853143 5:137350537-137350559 TCCCCTGCACTCACTCCTACAGG - Intronic
997880794 5:137587653-137587675 TTCCCTGCTCATTCTCAGCCTGG - Intronic
1001854560 5:174999705-174999727 TTCCCTGCAAACTCACAAGCTGG - Intergenic
1007116292 6:39345529-39345551 TTCCCTGGAATCTCTCACACAGG - Intronic
1007682824 6:43645916-43645938 TTCCCTGGTCACTACCATACAGG + Intronic
1010584184 6:77637784-77637806 TTTCCAGCACACGTTCATACTGG - Intergenic
1011173936 6:84539607-84539629 TTCTTTGCACACTCTCATCAAGG + Intergenic
1011222910 6:85076145-85076167 TTCCCTGCACACGCTCTTCTAGG - Intergenic
1013174394 6:107664852-107664874 TTCACTGCACACTCCCATTTGGG + Intergenic
1017696965 6:157025761-157025783 CTCCCTAAACACTCTCATATAGG + Intronic
1018458795 6:163977782-163977804 TCCTCTGCACACCCTCACACTGG + Intergenic
1018941801 6:168313456-168313478 TACCCTGCACACTTTTACACAGG + Intronic
1020149872 7:5673592-5673614 TTCCTTGCAGACCCTCATTCTGG - Intronic
1020777510 7:12473306-12473328 TTTTCTTCACATTCTCATACAGG + Intergenic
1021144591 7:17069415-17069437 TGCCCTGCACACACCCACACAGG + Intergenic
1022474635 7:30701876-30701898 GTCCCTGCACACTCTGAGGCTGG - Intronic
1022555599 7:31292265-31292287 TTCCAGGCACACTCTCAGAGAGG - Intergenic
1024147562 7:46532879-46532901 GTCCCTCCACACTCTCTTTCTGG + Intergenic
1024803271 7:53106066-53106088 TTGCCTGTCCACTCTCAGACTGG - Intergenic
1025155865 7:56605592-56605614 TTCCCTTCCTCCTCTCATACCGG - Intergenic
1025238393 7:57250787-57250809 TTAGCTGCACACTGTGATACTGG - Intergenic
1025762247 7:64405555-64405577 TTCCCTTCCTCCTCTCATACTGG + Intergenic
1027173564 7:75889326-75889348 TGCCCTGCACTGTCTCATAGAGG - Intergenic
1031221315 7:118969387-118969409 TTGCCTACACTCTCTAATACAGG - Intergenic
1031430644 7:121664224-121664246 TTACCTGCACACTGTCAAAGAGG - Intergenic
1034162081 7:149001432-149001454 TTCCCTGCAAACTAACATAAAGG + Intergenic
1038480624 8:27899322-27899344 TCCCCTGCTCACTCCCACACTGG - Intronic
1041135400 8:54752698-54752720 TACCCCCCACACTCTCACACTGG + Intergenic
1043592285 8:81845431-81845453 TTCCCGGAACACTCTTAGACTGG - Intergenic
1044266685 8:90190166-90190188 CTCCCTGCAAAATCTCATAGTGG + Intergenic
1048053400 8:130840855-130840877 TTCCCAGCAATCTCTGATACAGG + Intronic
1048120588 8:131576672-131576694 CTCCCTGCACAACCTCACACTGG - Intergenic
1048995474 8:139791362-139791384 TCCCCTGCACACACTCACACAGG + Intronic
1049387780 8:142353071-142353093 CTCCCAGGACACTCTCATTCAGG + Intronic
1052990863 9:34518777-34518799 TGCCCTGCCCACTCTGATCCAGG + Intronic
1052990883 9:34518862-34518884 TGCCCTGCCCACTCTGATCCAGG + Intronic
1052990903 9:34518947-34518969 TGCCCTGCCCACTCTGATCCAGG + Intronic
1053146600 9:35716357-35716379 TTCTGTGCACACTCCCAGACTGG - Intronic
1058646388 9:107135091-107135113 TTCGCTGCACTCTCTGATCCTGG - Intergenic
1060932210 9:127496274-127496296 TGCCCTGCACACTGTCTCACTGG + Intronic
1061185873 9:129052888-129052910 TTCCCTGCCGACTCGCAGACAGG - Intronic
1190989828 X:55535874-55535896 TTCCCAGCACACACACATGCAGG - Intergenic
1194424755 X:93722613-93722635 TGCCCTCCACACTCTCTTATGGG + Intergenic
1194865784 X:99064531-99064553 TTTTCTCCACACTCTTATACAGG - Intergenic
1195120183 X:101741899-101741921 TTCCCTGCCCCCTCACATATGGG + Intergenic
1196467670 X:115989994-115990016 TACCATGCCCACTCACATACTGG - Intergenic
1198736109 X:139786922-139786944 TTCCAGGCAAACTCTCATTCTGG + Intronic