ID: 995664307

View in Genome Browser
Species Human (GRCh38)
Location 5:114523965-114523987
Sequence CTGACTTTTTAGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995664307_995664310 8 Left 995664307 5:114523965-114523987 CCATGCTCCATCTAAAAAGTCAG No data
Right 995664310 5:114523996-114524018 CATAGCCGCTCACTTTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995664307 Original CRISPR CTGACTTTTTAGATGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr