ID: 995666192

View in Genome Browser
Species Human (GRCh38)
Location 5:114544925-114544947
Sequence CCAGTGAAGAAGGATGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995666192_995666201 -5 Left 995666192 5:114544925-114544947 CCTGACCCATCCTTCTTCACTGG No data
Right 995666201 5:114544943-114544965 ACTGGGTGGGGCTTCCCAGCAGG No data
995666192_995666206 23 Left 995666192 5:114544925-114544947 CCTGACCCATCCTTCTTCACTGG No data
Right 995666206 5:114544971-114544993 CAACTCCAGCCAGAGGCTTATGG No data
995666192_995666204 16 Left 995666192 5:114544925-114544947 CCTGACCCATCCTTCTTCACTGG No data
Right 995666204 5:114544964-114544986 GGAACTCCAACTCCAGCCAGAGG 0: 6
1: 15
2: 14
3: 30
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995666192 Original CRISPR CCAGTGAAGAAGGATGGGTC AGG (reversed) Intergenic
No off target data available for this crispr