ID: 995674991

View in Genome Browser
Species Human (GRCh38)
Location 5:114653513-114653535
Sequence CCCATGGTGTTGAGGGTCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995674986_995674991 14 Left 995674986 5:114653476-114653498 CCAGTACTTAAAGGTATACAACA No data
Right 995674991 5:114653513-114653535 CCCATGGTGTTGAGGGTCGTTGG No data
995674985_995674991 15 Left 995674985 5:114653475-114653497 CCCAGTACTTAAAGGTATACAAC No data
Right 995674991 5:114653513-114653535 CCCATGGTGTTGAGGGTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995674991 Original CRISPR CCCATGGTGTTGAGGGTCGT TGG Intergenic
No off target data available for this crispr