ID: 995678513

View in Genome Browser
Species Human (GRCh38)
Location 5:114690816-114690838
Sequence TCTCACATGGGTATGGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995678509_995678513 9 Left 995678509 5:114690784-114690806 CCAGTCTGTGGAGCAGTGAATTA No data
Right 995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995678513 Original CRISPR TCTCACATGGGTATGGTTTA TGG Intergenic
No off target data available for this crispr