ID: 995680289

View in Genome Browser
Species Human (GRCh38)
Location 5:114710063-114710085
Sequence TGATAGGTATAGAACTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995680289_995680295 12 Left 995680289 5:114710063-114710085 CCAAGCCAGTTCTATACCTATCA No data
Right 995680295 5:114710098-114710120 ATAGGAGAACCTACCGTTTCAGG No data
995680289_995680293 -6 Left 995680289 5:114710063-114710085 CCAAGCCAGTTCTATACCTATCA No data
Right 995680293 5:114710080-114710102 CTATCACCAGCAGTGGTCATAGG No data
995680289_995680296 13 Left 995680289 5:114710063-114710085 CCAAGCCAGTTCTATACCTATCA No data
Right 995680296 5:114710099-114710121 TAGGAGAACCTACCGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995680289 Original CRISPR TGATAGGTATAGAACTGGCT TGG (reversed) Intergenic
No off target data available for this crispr