ID: 995680293

View in Genome Browser
Species Human (GRCh38)
Location 5:114710080-114710102
Sequence CTATCACCAGCAGTGGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995680289_995680293 -6 Left 995680289 5:114710063-114710085 CCAAGCCAGTTCTATACCTATCA No data
Right 995680293 5:114710080-114710102 CTATCACCAGCAGTGGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995680293 Original CRISPR CTATCACCAGCAGTGGTCAT AGG Intergenic
No off target data available for this crispr