ID: 995680295

View in Genome Browser
Species Human (GRCh38)
Location 5:114710098-114710120
Sequence ATAGGAGAACCTACCGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995680289_995680295 12 Left 995680289 5:114710063-114710085 CCAAGCCAGTTCTATACCTATCA No data
Right 995680295 5:114710098-114710120 ATAGGAGAACCTACCGTTTCAGG No data
995680292_995680295 -4 Left 995680292 5:114710079-114710101 CCTATCACCAGCAGTGGTCATAG No data
Right 995680295 5:114710098-114710120 ATAGGAGAACCTACCGTTTCAGG No data
995680290_995680295 7 Left 995680290 5:114710068-114710090 CCAGTTCTATACCTATCACCAGC No data
Right 995680295 5:114710098-114710120 ATAGGAGAACCTACCGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995680295 Original CRISPR ATAGGAGAACCTACCGTTTC AGG Intergenic
No off target data available for this crispr