ID: 995680296

View in Genome Browser
Species Human (GRCh38)
Location 5:114710099-114710121
Sequence TAGGAGAACCTACCGTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995680290_995680296 8 Left 995680290 5:114710068-114710090 CCAGTTCTATACCTATCACCAGC No data
Right 995680296 5:114710099-114710121 TAGGAGAACCTACCGTTTCAGGG No data
995680289_995680296 13 Left 995680289 5:114710063-114710085 CCAAGCCAGTTCTATACCTATCA No data
Right 995680296 5:114710099-114710121 TAGGAGAACCTACCGTTTCAGGG No data
995680292_995680296 -3 Left 995680292 5:114710079-114710101 CCTATCACCAGCAGTGGTCATAG No data
Right 995680296 5:114710099-114710121 TAGGAGAACCTACCGTTTCAGGG No data
995680294_995680296 -10 Left 995680294 5:114710086-114710108 CCAGCAGTGGTCATAGGAGAACC No data
Right 995680296 5:114710099-114710121 TAGGAGAACCTACCGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995680296 Original CRISPR TAGGAGAACCTACCGTTTCA GGG Intergenic
No off target data available for this crispr