ID: 995687136

View in Genome Browser
Species Human (GRCh38)
Location 5:114783262-114783284
Sequence TCATCTCTGTTGACAACATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995687134_995687136 -4 Left 995687134 5:114783243-114783265 CCCAGTATGGTCAGTGTTCTCAT No data
Right 995687136 5:114783262-114783284 TCATCTCTGTTGACAACATGAGG No data
995687133_995687136 5 Left 995687133 5:114783234-114783256 CCTCTGCATCCCAGTATGGTCAG No data
Right 995687136 5:114783262-114783284 TCATCTCTGTTGACAACATGAGG No data
995687131_995687136 9 Left 995687131 5:114783230-114783252 CCATCCTCTGCATCCCAGTATGG No data
Right 995687136 5:114783262-114783284 TCATCTCTGTTGACAACATGAGG No data
995687135_995687136 -5 Left 995687135 5:114783244-114783266 CCAGTATGGTCAGTGTTCTCATC No data
Right 995687136 5:114783262-114783284 TCATCTCTGTTGACAACATGAGG No data
995687129_995687136 11 Left 995687129 5:114783228-114783250 CCCCATCCTCTGCATCCCAGTAT No data
Right 995687136 5:114783262-114783284 TCATCTCTGTTGACAACATGAGG No data
995687130_995687136 10 Left 995687130 5:114783229-114783251 CCCATCCTCTGCATCCCAGTATG No data
Right 995687136 5:114783262-114783284 TCATCTCTGTTGACAACATGAGG No data
995687128_995687136 22 Left 995687128 5:114783217-114783239 CCTGCTCTGTGCCCCATCCTCTG No data
Right 995687136 5:114783262-114783284 TCATCTCTGTTGACAACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995687136 Original CRISPR TCATCTCTGTTGACAACATG AGG Intergenic
No off target data available for this crispr