ID: 995690056

View in Genome Browser
Species Human (GRCh38)
Location 5:114815648-114815670
Sequence GTCTTTCTGATACCAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995690056_995690059 2 Left 995690056 5:114815648-114815670 CCAGACTTTGGTATCAGAAAGAC No data
Right 995690059 5:114815673-114815695 TGGCCTCATAAAATGAGTTAGGG 0: 8795
1: 4517
2: 2333
3: 2111
4: 1944
995690056_995690058 1 Left 995690056 5:114815648-114815670 CCAGACTTTGGTATCAGAAAGAC No data
Right 995690058 5:114815672-114815694 CTGGCCTCATAAAATGAGTTAGG 0: 8575
1: 5102
2: 3543
3: 3755
4: 3681
995690056_995690061 29 Left 995690056 5:114815648-114815670 CCAGACTTTGGTATCAGAAAGAC No data
Right 995690061 5:114815700-114815722 TTCCCTCTTTTTCTATTGATCGG 0: 6681
1: 3341
2: 1749
3: 1160
4: 1622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995690056 Original CRISPR GTCTTTCTGATACCAAAGTC TGG (reversed) Intergenic
No off target data available for this crispr