ID: 995690058

View in Genome Browser
Species Human (GRCh38)
Location 5:114815672-114815694
Sequence CTGGCCTCATAAAATGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24656
Summary {0: 8575, 1: 5102, 2: 3543, 3: 3755, 4: 3681}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995690056_995690058 1 Left 995690056 5:114815648-114815670 CCAGACTTTGGTATCAGAAAGAC No data
Right 995690058 5:114815672-114815694 CTGGCCTCATAAAATGAGTTAGG 0: 8575
1: 5102
2: 3543
3: 3755
4: 3681

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995690058 Original CRISPR CTGGCCTCATAAAATGAGTT AGG Intergenic
Too many off-targets to display for this crispr