ID: 995690059

View in Genome Browser
Species Human (GRCh38)
Location 5:114815673-114815695
Sequence TGGCCTCATAAAATGAGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19700
Summary {0: 8795, 1: 4517, 2: 2333, 3: 2111, 4: 1944}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995690056_995690059 2 Left 995690056 5:114815648-114815670 CCAGACTTTGGTATCAGAAAGAC No data
Right 995690059 5:114815673-114815695 TGGCCTCATAAAATGAGTTAGGG 0: 8795
1: 4517
2: 2333
3: 2111
4: 1944

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995690059 Original CRISPR TGGCCTCATAAAATGAGTTA GGG Intergenic
Too many off-targets to display for this crispr