ID: 995690061

View in Genome Browser
Species Human (GRCh38)
Location 5:114815700-114815722
Sequence TTCCCTCTTTTTCTATTGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14553
Summary {0: 6681, 1: 3341, 2: 1749, 3: 1160, 4: 1622}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995690056_995690061 29 Left 995690056 5:114815648-114815670 CCAGACTTTGGTATCAGAAAGAC No data
Right 995690061 5:114815700-114815722 TTCCCTCTTTTTCTATTGATCGG 0: 6681
1: 3341
2: 1749
3: 1160
4: 1622
995690060_995690061 1 Left 995690060 5:114815676-114815698 CCTCATAAAATGAGTTAGGGAGA 0: 182
1: 8902
2: 4470
3: 2440
4: 2474
Right 995690061 5:114815700-114815722 TTCCCTCTTTTTCTATTGATCGG 0: 6681
1: 3341
2: 1749
3: 1160
4: 1622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995690061 Original CRISPR TTCCCTCTTTTTCTATTGAT CGG Intergenic
Too many off-targets to display for this crispr