ID: 995695111

View in Genome Browser
Species Human (GRCh38)
Location 5:114870175-114870197
Sequence CACCCTTCCAAGACTGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995695109_995695111 -10 Left 995695109 5:114870162-114870184 CCCTGAACACATACACCCTTCCA No data
Right 995695111 5:114870175-114870197 CACCCTTCCAAGACTGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995695111 Original CRISPR CACCCTTCCAAGACTGAACA AGG Intergenic
No off target data available for this crispr