ID: 995695574

View in Genome Browser
Species Human (GRCh38)
Location 5:114875365-114875387
Sequence ATCTCCAGACTTTAAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995695574_995695575 -6 Left 995695574 5:114875365-114875387 CCTGCTATTTAAAGTCTGGAGAT No data
Right 995695575 5:114875382-114875404 GGAGATCCAGATTCTTTTCCAGG No data
995695574_995695579 20 Left 995695574 5:114875365-114875387 CCTGCTATTTAAAGTCTGGAGAT No data
Right 995695579 5:114875408-114875430 GAATTCTACTAGGCTTCTGTTGG No data
995695574_995695581 27 Left 995695574 5:114875365-114875387 CCTGCTATTTAAAGTCTGGAGAT No data
Right 995695581 5:114875415-114875437 ACTAGGCTTCTGTTGGAGCAGGG No data
995695574_995695577 10 Left 995695574 5:114875365-114875387 CCTGCTATTTAAAGTCTGGAGAT No data
Right 995695577 5:114875398-114875420 TTCCAGGCTTGAATTCTACTAGG No data
995695574_995695580 26 Left 995695574 5:114875365-114875387 CCTGCTATTTAAAGTCTGGAGAT No data
Right 995695580 5:114875414-114875436 TACTAGGCTTCTGTTGGAGCAGG No data
995695574_995695582 30 Left 995695574 5:114875365-114875387 CCTGCTATTTAAAGTCTGGAGAT No data
Right 995695582 5:114875418-114875440 AGGCTTCTGTTGGAGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995695574 Original CRISPR ATCTCCAGACTTTAAATAGC AGG (reversed) Intergenic
No off target data available for this crispr