ID: 995700337

View in Genome Browser
Species Human (GRCh38)
Location 5:114928882-114928904
Sequence CGTCCACCTGGAACTCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995700337_995700348 15 Left 995700337 5:114928882-114928904 CCAGCGTGAGTTCCAGGTGGACG No data
Right 995700348 5:114928920-114928942 CCACACTTGGAGCAGCCAGCTGG No data
995700337_995700343 -10 Left 995700337 5:114928882-114928904 CCAGCGTGAGTTCCAGGTGGACG No data
Right 995700343 5:114928895-114928917 CAGGTGGACGTGGGCTCGGTGGG No data
995700337_995700344 2 Left 995700337 5:114928882-114928904 CCAGCGTGAGTTCCAGGTGGACG No data
Right 995700344 5:114928907-114928929 GGCTCGGTGGGCCCCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995700337 Original CRISPR CGTCCACCTGGAACTCACGC TGG (reversed) Intergenic
No off target data available for this crispr