ID: 995704209

View in Genome Browser
Species Human (GRCh38)
Location 5:114969415-114969437
Sequence CCACATATATTGTAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995704209_995704214 20 Left 995704209 5:114969415-114969437 CCCTTTACCTACAATATATGTGG No data
Right 995704214 5:114969458-114969480 GTCATTTGCCTTTTGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995704209 Original CRISPR CCACATATATTGTAGGTAAA GGG (reversed) Intergenic
No off target data available for this crispr