ID: 995705180

View in Genome Browser
Species Human (GRCh38)
Location 5:114981394-114981416
Sequence TCACACTTTCTGTAATTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995705175_995705180 29 Left 995705175 5:114981342-114981364 CCTACTTGGAAAACAGCTTGATG No data
Right 995705180 5:114981394-114981416 TCACACTTTCTGTAATTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995705180 Original CRISPR TCACACTTTCTGTAATTTAG GGG Intergenic
No off target data available for this crispr