ID: 995710610

View in Genome Browser
Species Human (GRCh38)
Location 5:115031720-115031742
Sequence CAGGGCACTCACTGCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995710610 Original CRISPR CAGGGCACTCACTGCCATCT GGG Intergenic
900602349 1:3508588-3508610 CGGGGCAATCACAGCCATCCAGG + Exonic
901513335 1:9729409-9729431 CAGAGCACCCCCTGCCATCAGGG - Exonic
902225149 1:14992075-14992097 CAGGGCACTCACTGTCATGCTGG - Intronic
903368962 1:22822700-22822722 CAGGACATGCACTGGCATCTGGG + Intronic
903452830 1:23466211-23466233 CAGGGAGCTCACTGCCTTCAGGG - Intronic
904998717 1:34651366-34651388 CACTGCACTCTCTGCCACCTAGG - Intergenic
905920108 1:41713711-41713733 CAGGGAACTCACTACCTGCTGGG + Intronic
906151270 1:43589024-43589046 CAGTGCCCTCCCTGTCATCTGGG + Intronic
906513302 1:46423744-46423766 CAGGGCACCCACGCACATCTCGG - Intergenic
907119736 1:51998009-51998031 CAGGGCACACACTGTCAGCAGGG + Intergenic
907214724 1:52852437-52852459 CACTGCACTCTCTGCCTTCTGGG + Intronic
907267922 1:53274112-53274134 CAGGGCAGCCACTTCCATCCAGG + Intronic
908932459 1:69333209-69333231 AAGGGCAATAACTGCCATCATGG - Intergenic
913280883 1:117184010-117184032 CTGGGGACTCACTGCCAAGTAGG + Intronic
913466433 1:119148078-119148100 CAGTGCACCCACTGCCTTCTGGG - Intergenic
914048224 1:144107968-144107990 CCGGGGACTCACTGTCTTCTTGG - Intergenic
914130960 1:144857480-144857502 CCGGGGACTCACTGTCTTCTTGG + Intergenic
915074555 1:153297756-153297778 CTGGGCATTCACAGCCCTCTTGG - Intergenic
916101838 1:161399614-161399636 CCGGGATCTCACTGCGATCTGGG + Intergenic
919780064 1:201215887-201215909 CTGGGCCCTCCCTGCCATCAAGG + Intronic
919823756 1:201489440-201489462 CACGGCACTCCCTGGCCTCTGGG - Intronic
919941437 1:202289271-202289293 CAAGGCACTCACTGACATGCTGG - Intronic
920517317 1:206595517-206595539 CCGCTCACTCACTGCCCTCTAGG - Intronic
921355646 1:214281755-214281777 CTGGGCACTCACTGCCCTCCCGG + Intronic
923767408 1:236905122-236905144 GAGGGCACTAGCTGGCATCTTGG - Intergenic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1064719314 10:18212877-18212899 CAGGGCTCTCACTTCCAGTTTGG - Intronic
1064735625 10:18379236-18379258 CAGGGGTCTCACTGTCATCCAGG + Intronic
1065968346 10:30786333-30786355 CATGGTACTCACTGCCACCATGG + Intergenic
1066517250 10:36176856-36176878 CAGGACAGTCACTGTCACCTTGG - Intergenic
1070565382 10:77600176-77600198 CAGGGAGCTCACTGCCTCCTAGG - Intronic
1070765721 10:79054990-79055012 CAGGGCACTCACTGGAATGAGGG + Intergenic
1075278064 10:121113077-121113099 CAGGGCACACACAGGAATCTGGG + Intergenic
1076026006 10:127114029-127114051 CAGGGCAATCACAGGCCTCTTGG - Intronic
1076315093 10:129534243-129534265 CAGGGCTCTCTTTGCCCTCTCGG + Intronic
1076787678 10:132759225-132759247 CAGGCCCCTCAGTGCCAGCTTGG + Intronic
1077177669 11:1197994-1198016 CAGGCCACTCACTGCAGTTTTGG - Intronic
1077505496 11:2928214-2928236 CAGGGCACTTCCTGGCCTCTGGG + Intergenic
1078090601 11:8262474-8262496 CAGGGCACTCCCTGCCAGTAAGG + Intronic
1080100357 11:28452626-28452648 CCAGGCACTCACTGGGATCTAGG + Intergenic
1080959035 11:37136183-37136205 CAGGGGAGTCACTGCCTTCTGGG - Intergenic
1083034724 11:59626106-59626128 CCGCTCACTCACTGCAATCTTGG + Intergenic
1083655389 11:64226766-64226788 CGAGGCCATCACTGCCATCTGGG + Exonic
1084505561 11:69564695-69564717 CAGGACACTCACAGCCACCCAGG + Intergenic
1084557989 11:69886237-69886259 CAGGGAACCCACATCCATCTAGG - Intergenic
1084729237 11:71062580-71062602 CAGGCCACTCTCAGCCATCTGGG - Intronic
1084780427 11:71404654-71404676 GAGGGGTCTCACTGCCATCTTGG + Intergenic
1088893535 11:114061615-114061637 CAGTGCATTCACTGCAATATTGG + Intronic
1089189739 11:116645076-116645098 CAGATCACTCACTGCCAGCCAGG + Intergenic
1089564321 11:119363146-119363168 CAGGGCACGCACTGCCAGCACGG + Intronic
1091241028 11:134052622-134052644 GAGGTCATTCTCTGCCATCTTGG + Intergenic
1091668426 12:2435695-2435717 AAGGGCACTGAATGCCATCAAGG - Intronic
1091777853 12:3196270-3196292 CAGGTAACTCAAGGCCATCTGGG + Intronic
1095306871 12:40649463-40649485 CAGAGCACTCACTGAGCTCTGGG + Intergenic
1096181438 12:49553082-49553104 CAGAGCACTCACTACCCTCAAGG - Intronic
1098093785 12:66932742-66932764 CATTGCAATCTCTGCCATCTGGG + Intergenic
1099333983 12:81329895-81329917 CAGGGCTGGCAGTGCCATCTGGG - Intronic
1099508754 12:83508564-83508586 CAGAGCACACACAGCCTTCTGGG - Intergenic
1102945407 12:116983055-116983077 CTGGGCATTCACTTCCATCTTGG - Intronic
1103461464 12:121108156-121108178 CAGGGAACTCACTGCCCTGAAGG + Intergenic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1103560300 12:121790032-121790054 CATGGCACTCACTGCTCTGTCGG - Intronic
1104794271 12:131506256-131506278 CAGAGCACTCACTCCCAACCAGG + Intergenic
1104808559 12:131605415-131605437 GAGGTCACTCATTGCCATCTTGG + Intergenic
1104905195 12:132209598-132209620 CAAGTCACTCGTTGCCATCTTGG - Intronic
1105899973 13:24745629-24745651 CAGGTCAATCTCTGCCTTCTCGG - Intergenic
1107046607 13:35999572-35999594 CAAGGCCCTCCCTGCCATCAGGG + Intronic
1107951687 13:45467514-45467536 CAGGGCAATCTCTGCCTTCTGGG - Intronic
1108576574 13:51796395-51796417 CAGGACATTCACTGCTCTCTCGG - Intronic
1114949809 14:27735619-27735641 CATGGCAACCTCTGCCATCTGGG - Intergenic
1115513224 14:34158857-34158879 CATTGCACTCACTGCAATCCTGG - Intronic
1118173280 14:63410758-63410780 CAGTGCATTAACTGCCATGTTGG - Intronic
1118493581 14:66286129-66286151 GAGTGCAGTCACTGCAATCTCGG + Intergenic
1121590828 14:95107341-95107363 CAGGGCAATCACTTCAAGCTAGG - Intronic
1122320866 14:100855000-100855022 CAGGTCAGTCACAGCCATTTAGG + Intergenic
1123418156 15:20107560-20107582 CCGGGGACTCACTGTCTTCTTGG - Intergenic
1123527374 15:21114082-21114104 CCGGGGACTCACTGTCTTCTTGG - Intergenic
1124162351 15:27283760-27283782 CAGGAGACTCACAGCCATGTTGG + Intronic
1124454641 15:29829595-29829617 TTTGGCACTCCCTGCCATCTTGG - Intronic
1125541545 15:40472456-40472478 GAGGGCAGTCTCTGCCATCCAGG - Exonic
1126803264 15:52320029-52320051 CAGGGCACTGACAACCATCTTGG + Intronic
1129525693 15:76212695-76212717 CAGGGCTCCCACTGCTATCCTGG + Intronic
1130050252 15:80478498-80478520 CAGGGCCTTCTCTGGCATCTTGG - Intronic
1131121713 15:89827271-89827293 CATGGCACACACTGTCATATCGG + Intergenic
1131122929 15:89834242-89834264 TAGGGAACCCACTGCCACCTGGG - Exonic
1133788113 16:8988677-8988699 CAGGGCACTCACTGCTTGCGTGG - Intergenic
1133815277 16:9192591-9192613 CAGGGAGCTCACTACCTTCTAGG + Intergenic
1135009380 16:18861130-18861152 CAGGGAGCTCACTGGCAGCTTGG - Intronic
1135316420 16:21450055-21450077 CAGGGAGCTCACTGGCAGCTTGG - Intergenic
1135369342 16:21882306-21882328 CAGGGAGCTCACTGGCAGCTTGG - Intergenic
1135442471 16:22488827-22488849 CAGGGAGCTCACTGGCAGCTTGG + Intronic
1135589662 16:23695841-23695863 CATGGCACTCACAGCCCTCGTGG - Intronic
1135940340 16:26816848-26816870 CACGGCACTCTCTGGCAACTTGG + Intergenic
1135976967 16:27114920-27114942 CAGGGCACCCTCTGCCTTCAGGG - Intergenic
1136313090 16:29428767-29428789 CAGGGAGCTCACTGGCAGCTTGG - Intergenic
1136326534 16:29530537-29530559 CAGGGAGCTCACTGGCAGCTTGG - Intergenic
1136355939 16:29744865-29744887 CATGGCCCTCACTGCCCTGTGGG - Exonic
1136441224 16:30270522-30270544 CAGGGAGCTCACTGGCAGCTTGG - Intergenic
1139446302 16:67000769-67000791 CCTGGCACTCACTGGCAGCTGGG - Exonic
1140545301 16:75802209-75802231 CAGGTTACACACTGCCATGTCGG - Intergenic
1141458543 16:84161716-84161738 CTGGGCACTTGCTGTCATCTAGG + Intronic
1141962972 16:87421618-87421640 CAGGGCACTCTCTACCCTCTCGG - Intronic
1141995437 16:87634181-87634203 CAGGGCTCTCACTGTCACGTTGG + Intronic
1142124496 16:88403453-88403475 CAGAGCTCACACCGCCATCTCGG + Intergenic
1142540808 17:657641-657663 CAGGGCACTCCCTTCCTTCCAGG - Intronic
1144455470 17:15414934-15414956 CAGGATACTCACTACCATGTGGG + Intergenic
1144780809 17:17807550-17807572 CTGGGCACTCACTGACAGGTTGG - Intronic
1144782793 17:17816321-17816343 CAGGGCACTCAGCGCCAGGTTGG + Exonic
1145902178 17:28496289-28496311 CAGGTCACCCAGTGCCTTCTGGG + Intronic
1146369989 17:32259859-32259881 AAGGGCACTCACTACCATCAGGG + Intergenic
1150247700 17:63688756-63688778 CAGGGGAATCACTGGCTTCTGGG - Intronic
1151064886 17:71137570-71137592 TAGGGTCCTCACTGCCACCTGGG + Intergenic
1151534443 17:74730704-74730726 CAGGGCACACCCTGCCCTCAGGG + Intronic
1151534757 17:74732424-74732446 CAGGGGACTCCCTGCTATCCAGG - Intronic
1151684837 17:75640352-75640374 CATGGCTCTCCCTGGCATCTGGG + Intronic
1155274912 18:24177397-24177419 CAGTAAACTCACTGCCATATTGG + Intronic
1157220677 18:45826658-45826680 CAGGCCACACACTGACATCATGG + Intronic
1159092945 18:63870058-63870080 CAGGGCACTCACTGGGTGCTGGG + Intergenic
1160009051 18:75089902-75089924 CAGGGCCGTCACGGCCACCTGGG - Intergenic
1160012061 18:75113609-75113631 CAGGGCGCTCACAGTCATCCAGG - Intergenic
1160418778 18:78730006-78730028 CAGGGGAATCACTGCCAGTTTGG - Intergenic
1161404182 19:4082492-4082514 GAGGGCCCTCAGTGCCATCTTGG + Intergenic
1161516639 19:4700116-4700138 CAGGTCACTCACCTCCCTCTCGG - Intronic
1161729246 19:5948857-5948879 CTGGGCACTCACTGCGAGCCTGG - Intronic
1161939134 19:7391748-7391770 CAGGGGAGCCACTGGCATCTAGG + Intronic
1162623290 19:11861749-11861771 CAGGGGACACAATGCCATGTTGG + Intronic
1162820086 19:13217631-13217653 CAGGGAACTGAGTGGCATCTGGG + Intronic
1163385927 19:17000559-17000581 CTGGGCCCTCCCTGCCATCTTGG - Intronic
1166014365 19:39969121-39969143 CAAGAGACTTACTGCCATCTTGG + Intergenic
1167381086 19:49138417-49138439 CAGAGCACTCACAGCCTTGTCGG - Exonic
1168137542 19:54361408-54361430 CAGGGTCCTCACTGTCAACTGGG - Intronic
1168160528 19:54507670-54507692 CAGGGTCCTCACTGTCAACTGGG + Intronic
1202687676 1_KI270712v1_random:60863-60885 CCGGGGACTCACTGTCTTCTTGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925292415 2:2756504-2756526 CAGGGTTCTCACTGCCTTCAAGG + Intergenic
928118513 2:28565156-28565178 CTGGGCACTCTCTGGGATCTAGG - Intronic
930137321 2:47915542-47915564 AAAGGCACTCACTTTCATCTCGG + Intergenic
931170025 2:59793241-59793263 AAAGGCAATCACTGCCACCTCGG + Intergenic
933958678 2:87394722-87394744 CCGGGGACTCACTGTCTTCTTGG + Intergenic
934242808 2:90286728-90286750 CCGGGGACTCACTGTCTTCTTGG + Intergenic
934270368 2:91529955-91529977 CCGGGGACTCACTGTCTTCTTGG - Intergenic
935744990 2:106182659-106182681 CAGAGCACTGACAGCCCTCTGGG - Intronic
936553100 2:113467719-113467741 CAGGTCAATGACTGCCTTCTCGG - Intronic
938131002 2:128715561-128715583 CAGAGCACTCACCGTCAGCTGGG + Intergenic
939425411 2:142030159-142030181 CATGCCATTCACTGCCCTCTAGG - Intronic
940018967 2:149136473-149136495 CTGGTGACCCACTGCCATCTGGG - Intronic
940517632 2:154699762-154699784 CAGGGCACTAATTGCCCTCATGG - Intronic
942125209 2:172818022-172818044 CATGGCATTCACGGCAATCTGGG + Intronic
944710209 2:202328649-202328671 CAGTGCAATCTCTGCCTTCTGGG - Intergenic
946365118 2:219244289-219244311 CAGGGCACTCCCTGTCCTCAGGG - Intronic
947903459 2:233742195-233742217 CAGGGGACTCACAGCCTTCAGGG + Intronic
947922909 2:233893817-233893839 CAGGGTCCTCACTGCCAGCCAGG - Intergenic
1169630082 20:7621689-7621711 AAGGGGACTCACTGCCGCCTGGG + Intergenic
1170856587 20:20061890-20061912 CTGGGTACTCACTCCCAGCTAGG + Intronic
1171175381 20:23048220-23048242 CAGGGCACTCACAGCTAGCCTGG + Exonic
1171366667 20:24629540-24629562 AAAGGCACTCACAGCCACCTAGG + Intronic
1171779491 20:29406134-29406156 GAGGGCACTCACTGCCCTAAAGG + Intergenic
1172478910 20:35259515-35259537 AGGAGCACTCACTGCCAGCTGGG + Intronic
1172883422 20:38216320-38216342 CAGGGCACTCTCTGTCTCCTTGG - Intronic
1172993263 20:39051240-39051262 CCTGGCACTCACTGCCAGCTTGG - Intergenic
1173737211 20:45370716-45370738 CTGTGCACTGACTGCCTTCTGGG - Intronic
1174540843 20:51288213-51288235 CTGGGCACTGACTGCCTTCCTGG - Intergenic
1174602099 20:51733176-51733198 CAGGTCACTCACTGCACTATGGG + Intronic
1175963428 20:62648367-62648389 CAGGGCACCCACTCACCTCTCGG - Intronic
1176650567 21:9543056-9543078 CAGGGGACTCACTTGAATCTGGG - Intergenic
1179337253 21:40468987-40469009 CTGGGCACTGAGTGGCATCTTGG - Intronic
1180969297 22:19806713-19806735 CAGGGCGCACACTGACGTCTTGG + Exonic
1181513264 22:23398232-23398254 CTGGGCAGTCCCTGCCCTCTAGG + Intergenic
1184685256 22:46093927-46093949 CAGGGCACTCAGAGCCTCCTGGG + Intronic
951017520 3:17746328-17746350 CAGGCCACTCTCTGCCTTGTCGG - Intronic
956019666 3:64920775-64920797 CAGGGTACTCACAGGCATGTGGG + Intergenic
957085654 3:75674518-75674540 GAGGGCACTCACTGCCCTAAAGG - Intergenic
958136828 3:89504610-89504632 CACGGCTGTCACTGCCACCTGGG + Intergenic
958498052 3:94870778-94870800 CACGGCAAGCTCTGCCATCTGGG + Intergenic
959965383 3:112347879-112347901 CAGGACATTCACTGCCTTCCAGG - Intronic
959980132 3:112506847-112506869 TAGGGCCTTCACTGCCATCAAGG - Intergenic
961317516 3:126050679-126050701 CAAGGCACCCACTGACATTTAGG + Intronic
962410979 3:135141642-135141664 CTAGGCACTCACTCCCATCCAGG - Intronic
963492285 3:146016827-146016849 CAAGGCACCCACTGCCATTCCGG + Intergenic
963944827 3:151134503-151134525 CAGTGTAATCACTGCCCTCTAGG + Intronic
964380963 3:156098728-156098750 CAGGGCTGGCAGTGCCATCTGGG + Intronic
964929260 3:161996351-161996373 CAGCTCACTCACAGTCATCTCGG - Intergenic
967035900 3:185648015-185648037 CAGGGCACACACTGCGCTTTAGG - Intronic
967350899 3:188512499-188512521 AATGGCACTCACTGCAACCTTGG - Intronic
968008171 3:195256856-195256878 CAGGGCACTGCCTGCCAGCCGGG + Intronic
970889738 4:21029642-21029664 GAGTGCACTACCTGCCATCTGGG + Intronic
979449672 4:120855488-120855510 CAGAACACTCACTGCCCACTGGG + Intronic
985444359 4:190013007-190013029 GAGGGCACTCACTGCCCTAAAGG + Intergenic
986317569 5:6600797-6600819 CAGGGCTCAGACTGCCATGTGGG - Intronic
987313137 5:16699709-16699731 CAGTGCAGTCACTGCCTCCTGGG - Intronic
993682288 5:90894640-90894662 CAGGGAACTCACTGGAGTCTGGG - Intronic
994089232 5:95794112-95794134 CAGGGCCTCCACTGCCACCTTGG + Exonic
995710610 5:115031720-115031742 CAGGGCACTCACTGCCATCTGGG + Intergenic
996749124 5:126871480-126871502 CAGGACACTCAGTGCCATGTGGG - Intronic
997786019 5:136714787-136714809 CAGGACCCTCATTGCCATCCAGG + Intergenic
999380270 5:151116684-151116706 CAGGACACTCCCTCCAATCTCGG + Intronic
999616888 5:153434323-153434345 TAGGGCTCTGACAGCCATCTTGG + Intergenic
999931835 5:156441921-156441943 CTGTGCACTCACTGTCATCAGGG + Intronic
1000387076 5:160684908-160684930 CCTGGCAGTCACTGCCATCAAGG - Intronic
1001786802 5:174420583-174420605 CAGGGCAACCTCTGCCATCCAGG - Intergenic
1002417878 5:179130248-179130270 CAGGGCTCCCAGAGCCATCTGGG - Intronic
1004401632 6:15294172-15294194 AAGGGCACTCCCTTCCCTCTGGG - Intronic
1006347812 6:33497711-33497733 CAGGGCACCCACTGGCTTCATGG - Intergenic
1006471014 6:34228626-34228648 CAGGGCAACCTCTGCCACCTGGG - Intergenic
1011111121 6:83837583-83837605 CAGGGGAGTCAGTGCCTTCTGGG - Intergenic
1011274080 6:85611651-85611673 CTGGACACTCACTGTCATCAAGG + Intronic
1012654600 6:101799709-101799731 CAAGGAACTGACTGTCATCTGGG - Exonic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1018768214 6:166950764-166950786 CATGGCACTCACGGCCCTCCGGG - Intronic
1018975463 6:168561909-168561931 CAAGGCTCTCACTGCATTCTTGG + Intronic
1018975475 6:168562013-168562035 CAAGGCTCTCACTGCATTCTTGG + Intronic
1018975482 6:168562065-168562087 CAAGGCTCTCACTGCATTCTTGG + Intronic
1018975495 6:168562169-168562191 CAAGGCTCTCACTGCATTCTTGG + Intronic
1018975508 6:168562273-168562295 CAAGGCTCTCACTGCATTCTTGG + Intronic
1018975522 6:168562377-168562399 CAAGGCTCTCACTGCATTCTTGG + Intronic
1019667416 7:2258831-2258853 CTGTGCACTCACTGCCCTGTTGG - Intronic
1020068646 7:5210543-5210565 CAGGGCAGTGCCTGCCATCACGG - Intronic
1020490643 7:8779721-8779743 CAGGTCACTCTTTCCCATCTTGG - Intergenic
1023266364 7:38410366-38410388 CAGGCCCCACACTGCCATCTGGG - Intronic
1023288445 7:38643812-38643834 TAGGGTCCTCACTGCCAGCTGGG + Intergenic
1027425866 7:78061086-78061108 CAGGGGAATCTCTGCCTTCTGGG - Intronic
1029587996 7:101487498-101487520 CGGTGCCCTCCCTGCCATCTTGG + Intronic
1033070563 7:138198026-138198048 CAGGGAAATCCCTGCCATATTGG + Intergenic
1033502947 7:141972003-141972025 CAGGGCACCTACTGGCATCCAGG + Intronic
1034099744 7:148440329-148440351 AATGGCAGTCACTGCCATGTTGG - Intergenic
1035027678 7:155836583-155836605 CAAGTCACTTCCTGCCATCTGGG - Intergenic
1038267224 8:26046593-26046615 CAGGGCACTTTCTCCCCTCTTGG + Intergenic
1038863049 8:31408652-31408674 CAGGAAATTCACTGCCCTCTGGG + Intergenic
1039491326 8:37949652-37949674 CAGGTCACTCATGGACATCTTGG + Intergenic
1041068310 8:54102779-54102801 CAGGGCTGCCACTGCCAGCTAGG - Intergenic
1044092119 8:88015020-88015042 CAGGGCAATCTCTGCCTTCTGGG + Intergenic
1044940900 8:97342416-97342438 CAGGTCACTCACTGCCTGATTGG - Intergenic
1045945101 8:107786694-107786716 CAGAGTACACACTGTCATCTAGG - Intergenic
1046197739 8:110885577-110885599 CAGAGCATACACAGCCATCTGGG - Intergenic
1053742949 9:41159760-41159782 CAGGTCAATGACTGCCTTCTCGG + Intronic
1054348226 9:63989584-63989606 CAGGTCAATGACTGCCTTCTCGG + Intergenic
1054445952 9:65315943-65315965 CAGGTCAATGACTGCCTTCTCGG + Intergenic
1054484318 9:65705567-65705589 CAGGTCAATGACTGCCTTCTCGG - Intronic
1054685394 9:68271540-68271562 CAGGTCAATGACTGCCTTCTCGG - Intronic
1057196786 9:93119938-93119960 CAGGGCACACACATCCAACTGGG + Intergenic
1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG + Intergenic
1059823156 9:117996530-117996552 CAGGGCATTGACTGAAATCTTGG - Intergenic
1060034271 9:120241727-120241749 CAGGGAACTCACTGTCTCCTAGG - Intergenic
1061117621 9:128624618-128624640 CAGACCACTGACTGCCAGCTAGG + Intronic
1061577220 9:131514550-131514572 CAAGGCCCTCACAGCCCTCTGGG - Intronic
1061981782 9:134109402-134109424 CAGGGAGCTCACTGCCCTCTAGG - Intergenic
1062442337 9:136576404-136576426 CAAGGACCTCACTGCCAGCTGGG + Intergenic
1062610764 9:137372437-137372459 CAGGGCGCTCACTGCCGTGCCGG + Intronic
1203628307 Un_KI270750v1:46609-46631 CAGGGGACTCACTTGAATCTGGG - Intergenic
1185534181 X:846469-846491 CCGGGGACTCACTGTCTTCTTGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1187963825 X:24591322-24591344 CAAGGCTCTCACTGGGATCTTGG - Intronic
1191589337 X:62863763-62863785 CAGGGTACATACTGCCATTTTGG + Intergenic
1192739000 X:73875277-73875299 CACTGCAATCACTGCCTTCTGGG + Intergenic
1194012747 X:88582901-88582923 CAGGGAACTCACAACTATCTGGG + Intergenic
1195117099 X:101710415-101710437 GAGGTCACTCATTGCCATCTTGG - Intergenic
1195134990 X:101896783-101896805 CAGGGTATACTCTGCCATCTTGG + Intronic
1201264006 Y:12188334-12188356 GATGTCACTCATTGCCATCTTGG - Intergenic