ID: 995714295

View in Genome Browser
Species Human (GRCh38)
Location 5:115067104-115067126
Sequence AAACTTCCCACTGTGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995714293_995714295 -8 Left 995714293 5:115067089-115067111 CCACTGACATATTCAAAACTTCC No data
Right 995714295 5:115067104-115067126 AAACTTCCCACTGTGAAGGCTGG No data
995714292_995714295 -4 Left 995714292 5:115067085-115067107 CCATCCACTGACATATTCAAAAC No data
Right 995714295 5:115067104-115067126 AAACTTCCCACTGTGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995714295 Original CRISPR AAACTTCCCACTGTGAAGGC TGG Intergenic
No off target data available for this crispr