ID: 995714495

View in Genome Browser
Species Human (GRCh38)
Location 5:115068784-115068806
Sequence CAGAAAAAGGAGAAGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995714495_995714503 16 Left 995714495 5:115068784-115068806 CCCCTCCTCTTCTCCTTTTTCTG No data
Right 995714503 5:115068823-115068845 ATTTCTATCCGCTTGTGGGTTGG No data
995714495_995714505 20 Left 995714495 5:115068784-115068806 CCCCTCCTCTTCTCCTTTTTCTG No data
Right 995714505 5:115068827-115068849 CTATCCGCTTGTGGGTTGGCGGG No data
995714495_995714502 12 Left 995714495 5:115068784-115068806 CCCCTCCTCTTCTCCTTTTTCTG No data
Right 995714502 5:115068819-115068841 AGCTATTTCTATCCGCTTGTGGG No data
995714495_995714504 19 Left 995714495 5:115068784-115068806 CCCCTCCTCTTCTCCTTTTTCTG No data
Right 995714504 5:115068826-115068848 TCTATCCGCTTGTGGGTTGGCGG No data
995714495_995714501 11 Left 995714495 5:115068784-115068806 CCCCTCCTCTTCTCCTTTTTCTG No data
Right 995714501 5:115068818-115068840 TAGCTATTTCTATCCGCTTGTGG No data
995714495_995714507 29 Left 995714495 5:115068784-115068806 CCCCTCCTCTTCTCCTTTTTCTG No data
Right 995714507 5:115068836-115068858 TGTGGGTTGGCGGGCCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995714495 Original CRISPR CAGAAAAAGGAGAAGAGGAG GGG (reversed) Intergenic
No off target data available for this crispr