ID: 995714619

View in Genome Browser
Species Human (GRCh38)
Location 5:115069803-115069825
Sequence AAGGAGATCTTCTGCCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995714619_995714620 -5 Left 995714619 5:115069803-115069825 CCTCATTGGCAGAAGATCTCCTT No data
Right 995714620 5:115069821-115069843 TCCTTCTGTTAAGAAACTACAGG No data
995714619_995714622 10 Left 995714619 5:115069803-115069825 CCTCATTGGCAGAAGATCTCCTT No data
Right 995714622 5:115069836-115069858 ACTACAGGATGAATAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995714619 Original CRISPR AAGGAGATCTTCTGCCAATG AGG (reversed) Intergenic
No off target data available for this crispr