ID: 995714620

View in Genome Browser
Species Human (GRCh38)
Location 5:115069821-115069843
Sequence TCCTTCTGTTAAGAAACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995714617_995714620 -3 Left 995714617 5:115069801-115069823 CCCCTCATTGGCAGAAGATCTCC No data
Right 995714620 5:115069821-115069843 TCCTTCTGTTAAGAAACTACAGG No data
995714619_995714620 -5 Left 995714619 5:115069803-115069825 CCTCATTGGCAGAAGATCTCCTT No data
Right 995714620 5:115069821-115069843 TCCTTCTGTTAAGAAACTACAGG No data
995714618_995714620 -4 Left 995714618 5:115069802-115069824 CCCTCATTGGCAGAAGATCTCCT No data
Right 995714620 5:115069821-115069843 TCCTTCTGTTAAGAAACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995714620 Original CRISPR TCCTTCTGTTAAGAAACTAC AGG Intergenic
No off target data available for this crispr