ID: 995714622

View in Genome Browser
Species Human (GRCh38)
Location 5:115069836-115069858
Sequence ACTACAGGATGAATAAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995714619_995714622 10 Left 995714619 5:115069803-115069825 CCTCATTGGCAGAAGATCTCCTT No data
Right 995714622 5:115069836-115069858 ACTACAGGATGAATAAGTTCTGG No data
995714617_995714622 12 Left 995714617 5:115069801-115069823 CCCCTCATTGGCAGAAGATCTCC No data
Right 995714622 5:115069836-115069858 ACTACAGGATGAATAAGTTCTGG No data
995714621_995714622 -9 Left 995714621 5:115069822-115069844 CCTTCTGTTAAGAAACTACAGGA No data
Right 995714622 5:115069836-115069858 ACTACAGGATGAATAAGTTCTGG No data
995714618_995714622 11 Left 995714618 5:115069802-115069824 CCCTCATTGGCAGAAGATCTCCT No data
Right 995714622 5:115069836-115069858 ACTACAGGATGAATAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995714622 Original CRISPR ACTACAGGATGAATAAGTTC TGG Intergenic
No off target data available for this crispr