ID: 995714790

View in Genome Browser
Species Human (GRCh38)
Location 5:115071905-115071927
Sequence ATAAACAGTCTTGCCTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995714790_995714791 -3 Left 995714790 5:115071905-115071927 CCTTCTGAGGCAAGACTGTTTAT No data
Right 995714791 5:115071925-115071947 TATTCATTATTAAAAGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995714790 Original CRISPR ATAAACAGTCTTGCCTCAGA AGG (reversed) Intergenic