ID: 995715931

View in Genome Browser
Species Human (GRCh38)
Location 5:115081989-115082011
Sequence TCTGGAAATTGAAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 9, 1: 16, 2: 14, 3: 60, 4: 612}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995715931_995715943 30 Left 995715931 5:115081989-115082011 CCTTCCTTCCTTCAATTTCCAGA 0: 9
1: 16
2: 14
3: 60
4: 612
Right 995715943 5:115082042-115082064 GTCTGAGCTGCTGGAGCTAGGGG No data
995715931_995715940 21 Left 995715931 5:115081989-115082011 CCTTCCTTCCTTCAATTTCCAGA 0: 9
1: 16
2: 14
3: 60
4: 612
Right 995715940 5:115082033-115082055 GTAATGGCAGTCTGAGCTGCTGG No data
995715931_995715941 28 Left 995715931 5:115081989-115082011 CCTTCCTTCCTTCAATTTCCAGA 0: 9
1: 16
2: 14
3: 60
4: 612
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715931_995715942 29 Left 995715931 5:115081989-115082011 CCTTCCTTCCTTCAATTTCCAGA 0: 9
1: 16
2: 14
3: 60
4: 612
Right 995715942 5:115082041-115082063 AGTCTGAGCTGCTGGAGCTAGGG No data
995715931_995715938 5 Left 995715931 5:115081989-115082011 CCTTCCTTCCTTCAATTTCCAGA 0: 9
1: 16
2: 14
3: 60
4: 612
Right 995715938 5:115082017-115082039 CCGGAGATCCTGTGCTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995715931 Original CRISPR TCTGGAAATTGAAGGAAGGA AGG (reversed) Intergenic
900939214 1:5786995-5787017 TCGGCAAATGGAAGGAAGGAGGG + Intergenic
901095798 1:6678393-6678415 ACTGGAAATGGAAGGATGGGAGG - Exonic
902119906 1:14154981-14155003 TCAGAAAAAGGAAGGAAGGAAGG - Intergenic
902540967 1:17154455-17154477 TCTGGAAATTGAAAAAGGCAAGG - Intergenic
902701877 1:18178062-18178084 TCAGGAAAAAGAAGAAAGGAAGG + Intronic
902725334 1:18331929-18331951 TCTGGACATTCAAGGAACTAGGG + Intronic
904193969 1:28770844-28770866 AATGGAAAGGGAAGGAAGGAAGG - Intergenic
904198106 1:28801173-28801195 TCTGTAAACTGAAGGAGGGTGGG + Intergenic
904400293 1:30252397-30252419 TCTGTAAATTGAGGGAGAGAGGG + Intergenic
904434314 1:30484352-30484374 TTTGGAAAATGAAGGAATGAAGG + Intergenic
905718988 1:40179674-40179696 TCTGGAGATGGATGGATGGATGG - Intronic
906920023 1:50054299-50054321 TCTGGAAAAGGGAGGAAGGCAGG + Intronic
906968975 1:50490378-50490400 TCTCAAAAAGGAAGGAAGGAAGG + Intronic
907003386 1:50885769-50885791 TCTGTAAAAGGAAGAAAGGAAGG - Intronic
907029878 1:51160540-51160562 TCTGTAGATTGGAGGCAGGAGGG - Intergenic
907222382 1:52916465-52916487 TCAGGAAATTGAAGGCCAGAAGG - Intronic
907509945 1:54950542-54950564 TCTGGACCCTGAAAGAAGGAAGG + Intergenic
907664172 1:56419547-56419569 TCTCAAAAAGGAAGGAAGGAAGG - Intergenic
908159847 1:61395932-61395954 TCTAAAAATTGAAATAAGGAAGG - Intronic
908762685 1:67526489-67526511 TCTTCAAAAAGAAGGAAGGAAGG + Intergenic
908783858 1:67715912-67715934 TCTAAAACTTGAAGGGAGGAAGG + Intronic
909584188 1:77270718-77270740 TCTTGAAGCTGAAGGAAGGTAGG - Intergenic
909678765 1:78267815-78267837 TAAGCAAATGGAAGGAAGGAAGG - Intergenic
909749475 1:79141140-79141162 ACTGGAAAGTGAAGGACAGAAGG + Intergenic
910740941 1:90515512-90515534 TCTGAATTTTGGAGGAAGGAAGG + Intergenic
911422352 1:97659832-97659854 GGTGGAAATTGAAGAAATGAAGG - Intronic
911534415 1:99082814-99082836 CATGGAAATGGAAGAAAGGAAGG - Intergenic
912957227 1:114164062-114164084 TCTGGAACTGGAAGGAATGGGGG + Intergenic
913103672 1:115593130-115593152 TCTGGATAGAGAAGGAATGAGGG - Intergenic
914793618 1:150901445-150901467 TCTTGAAAATGAAGAAAGGTGGG + Intergenic
915895245 1:159806949-159806971 TCTGAACATAAAAGGAAGGAAGG - Intronic
916115928 1:161485088-161485110 TCTGGAAATTGAAGGAAGGAGGG - Intergenic
916510437 1:165468300-165468322 CCTGGAGAATGAAGGAAGGAGGG + Intergenic
916796707 1:168174176-168174198 TCTGGGACTTGATGGAGGGAAGG - Intergenic
917077325 1:171218831-171218853 CCTAGACATTGTAGGAAGGATGG - Intergenic
917656876 1:177135381-177135403 TCTGGAGAATGCAGGAAGCAGGG - Intronic
918548807 1:185716153-185716175 TCTGTAACAGGAAGGAAGGAAGG - Intergenic
919544135 1:198892269-198892291 TGAGGTAATTGCAGGAAGGAAGG + Intergenic
920039744 1:203087679-203087701 ACAGGAAATGGAGGGAAGGAGGG + Intergenic
920122285 1:203667745-203667767 TCTGGCCATTGGAGGAGGGAGGG + Intronic
921274204 1:213501946-213501968 ACAGGAAATGGAAGGATGGAGGG - Intergenic
923496917 1:234533754-234533776 CCTGGAAATTCTAGAAAGGAAGG - Intergenic
923584878 1:235259627-235259649 TGTGGAAACTGAAGGTAGGGTGG + Intronic
924009276 1:239646866-239646888 TGTGGAAATTGACTGAAGGTGGG + Intronic
924711356 1:246532414-246532436 TCTGGAAATTGAAGGAAGGAAGG + Intergenic
924827102 1:247551163-247551185 TGTAGAAATAAAAGGAAGGAAGG + Intronic
1062905739 10:1178436-1178458 CCGAGAAAGTGAAGGAAGGATGG - Exonic
1063235990 10:4117276-4117298 AGAGGAAATGGAAGGAAGGAAGG + Intergenic
1063525231 10:6778763-6778785 GAAGGAAATGGAAGGAAGGAAGG + Intergenic
1063565516 10:7170126-7170148 TCTGGAAGGTGGAGAAAGGAGGG + Intronic
1064266568 10:13830235-13830257 CCTGCAAATGGAGGGAAGGAGGG - Intronic
1064695753 10:17963754-17963776 CCTGGAAATTCAAGTAATGATGG - Intronic
1065261281 10:23926114-23926136 TCAGGAAAAAGAAGGAAGAAGGG + Intronic
1066052623 10:31649213-31649235 ACTGAAAATTGGAGGAAGGGAGG - Intergenic
1066619042 10:37324741-37324763 TCTGGAAATAGAAGGAAGGAGGG + Intronic
1066712939 10:38255325-38255347 TCTGGAATATGAAGAAATGAAGG - Intergenic
1068882504 10:62065388-62065410 TATGGAAGTGAAAGGAAGGAAGG - Intronic
1069178693 10:65327590-65327612 TCAGGAAATTGAAAGCAGTAAGG - Intergenic
1069793567 10:71038913-71038935 TTTGGAAATTGTGGGGAGGAAGG + Intergenic
1071256491 10:83876525-83876547 GCTGGAAAGTCAAAGAAGGAAGG + Intergenic
1071463551 10:85920445-85920467 TCTGTTGAATGAAGGAAGGAAGG - Intronic
1071686669 10:87765183-87765205 TCTGGTAGTTCAAGGAAGGAGGG + Intronic
1071889377 10:89986129-89986151 TCTGGGAATTGAGGGAAGTGTGG - Intergenic
1072403376 10:95127627-95127649 TCTGGAAATTGAAGGAAGAAAGG - Intergenic
1072533999 10:96345979-96346001 TATAGAAATGGAAAGAAGGAGGG - Exonic
1072681268 10:97508680-97508702 TGGGGAAATTAAAGGAAGAAGGG - Intronic
1073439679 10:103545072-103545094 ACTGGAAAGGGAAGAAAGGAAGG + Intronic
1073729373 10:106271148-106271170 TCTGGTAATTGAAGGGAGGAAGG + Intergenic
1074035519 10:109734528-109734550 TTTAGAAAGTGAAGGAAGAATGG - Intergenic
1074282748 10:112068623-112068645 TCTGGAAACAGAAGGAGGCAAGG - Intergenic
1074315748 10:112360293-112360315 TTTAGAAATTGAAGGGAGGCAGG - Intergenic
1074809623 10:117090744-117090766 TGTGAAAACAGAAGGAAGGAAGG + Intronic
1075587592 10:123668869-123668891 TCTGGAAGTTGGAGGAAGAGTGG - Intronic
1075818780 10:125287427-125287449 TTAGGAAATTGAAGGAATGCTGG + Intergenic
1075855528 10:125626301-125626323 TGTGGAAAGTGAAGGCAGGAAGG - Intronic
1076444127 10:130500322-130500344 TCAGGAGATGGAAGGGAGGAAGG - Intergenic
1077147688 11:1053299-1053321 TGTGGGAACTGCAGGAAGGAGGG - Intergenic
1078849833 11:15153598-15153620 TTTGGAAATGGGAGAAAGGATGG - Intronic
1078884076 11:15482452-15482474 TCTGGAAGCAGAAAGAAGGAAGG - Intergenic
1079074213 11:17373573-17373595 TCTGGAGTTCGAAGGGAGGAAGG + Exonic
1080031088 11:27661941-27661963 TGTGGAATTTTAGGGAAGGAAGG - Intronic
1080050807 11:27857132-27857154 GCTGGAAAAGGAAGGAAGGTGGG - Intergenic
1080726191 11:34901462-34901484 TCTGGAAATCAAAGGAAGGAAGG + Intronic
1080774948 11:35377185-35377207 TCAGGAAATTGAAGGTCAGAGGG + Intronic
1080796857 11:35572338-35572360 TCTGTTCAATGAAGGAAGGAAGG + Intergenic
1080874510 11:36263867-36263889 TCTTGGAACTGAAGGAAGGTTGG + Intergenic
1081072066 11:38623587-38623609 TAATGAAATTGAAGGAAAGATGG - Intergenic
1081384288 11:42452878-42452900 ACAGGAAATTGTATGAAGGAAGG - Intergenic
1082181106 11:49120862-49120884 CAGGGAAATGGAAGGAAGGAAGG - Intergenic
1082999088 11:59275345-59275367 TCTGGAGATCGAAGGGAAGAAGG + Intergenic
1083104621 11:60345987-60346009 TCTGGAAATTAAAGGAAGGAAGG - Intronic
1083125172 11:60558112-60558134 GCTGGAAAAAGAAGGGAGGAGGG + Intergenic
1083492239 11:63021567-63021589 TTTGGAGAATGAAGGAAGAATGG + Intergenic
1084471564 11:69362547-69362569 TCTGGAGAAAGAAAGAAGGAGGG + Intronic
1085220871 11:74872784-74872806 TCTGAAAATTGAAGGAAGGAAGG + Intronic
1086867832 11:92001686-92001708 TGGAGAAAATGAAGGAAGGAGGG + Intergenic
1087124100 11:94606267-94606289 TCATGAATTGGAAGGAAGGAAGG + Intronic
1087198003 11:95319804-95319826 TCTGGGAAGTGAAGGCAGGTGGG + Intergenic
1087370756 11:97280320-97280342 TCTGTAAAGGGAAGGAAAGATGG + Intergenic
1087515090 11:99149296-99149318 TCTGAAAAAAGAAGGAAAGAAGG + Intronic
1087804565 11:102541873-102541895 CTTGGAAATTGAAGAGAGGAGGG - Intergenic
1088128982 11:106464474-106464496 TCTGCATATTGAATGAATGAAGG + Intergenic
1088359052 11:108972152-108972174 TTTGGAAATAAAAGGAATGAAGG - Intergenic
1088375128 11:109132518-109132540 TCTGGACAAGGAAGGAAAGAAGG + Intergenic
1088390253 11:109306211-109306233 ACAGGAAGTTGAAAGAAGGAAGG - Intergenic
1088447152 11:109944016-109944038 TCTTGCAAGAGAAGGAAGGAAGG + Intergenic
1088573755 11:111249756-111249778 TCAGGAAAATGAAAGAAAGAGGG - Intergenic
1088905440 11:114151874-114151896 TCTGGAAGCTGAAGGTAGGGAGG + Intronic
1088952989 11:114589327-114589349 TCTGGAAACTGAAGGAAGGAAGG + Intronic
1089464110 11:118672978-118673000 TCTGGAAGTTAAAGGGAAGAGGG - Intronic
1089760407 11:120718589-120718611 CCTTGAGATGGAAGGAAGGAGGG + Intronic
1090086189 11:123653495-123653517 TCAGGAAACTGGAGGAAGGGCGG + Intronic
1090651636 11:128811514-128811536 ACTGGAATTTGATGGAAAGAAGG + Exonic
1090717742 11:129445051-129445073 CCAAGAAATTGAAGGAAGAATGG + Intronic
1091511159 12:1127761-1127783 GCTGCATATTGAAGGAGGGATGG + Intronic
1091570459 12:1680817-1680839 TCTGGAAGCTGAATGAAGCAAGG - Intergenic
1091920976 12:4304225-4304247 TGTGGGAATTGGAGGTAGGAAGG + Exonic
1091957798 12:4662226-4662248 TCTGTAAATAGAAGGAAAAATGG + Intronic
1092086285 12:5765084-5765106 CCTGGAAAAGGAAGGAAGAAAGG + Intronic
1092256600 12:6929260-6929282 TCCGGAAATTGGAGGGTGGAGGG - Intronic
1092274356 12:7048007-7048029 TCTGAAAAAGAAAGGAAGGAAGG - Intronic
1092903839 12:13084538-13084560 TCTGGAAATTGGAGAAATGGAGG - Intronic
1092990354 12:13891332-13891354 TCAGGACCTTGAAGGGAGGAGGG - Intronic
1093133320 12:15418575-15418597 TCTAGAATTTGAAGGAAAAATGG + Intronic
1093595168 12:20950705-20950727 TTTGGAAATTGAAGGAATGAGGG - Intergenic
1093638090 12:21495128-21495150 TCTGGAAATTCGTCGAAGGATGG - Intronic
1093853571 12:24070533-24070555 TCAGGAAATTCAAGGAATCATGG + Intergenic
1093975025 12:25412103-25412125 TTTAGAAATAGAAGGAAGGTAGG - Intronic
1095220974 12:39614132-39614154 TGTGGAAATTGAAGGACAAAAGG + Intronic
1095401644 12:41820915-41820937 TCTGAAAAGAGAAGAAAGGATGG - Intergenic
1095640279 12:44478922-44478944 TCTGGAAATTGAAGTAAGGAAGG + Intergenic
1096004872 12:48161388-48161410 TCAAGAGAGTGAAGGAAGGAAGG + Intronic
1096379123 12:51140590-51140612 TCTAAAAAATGAAGGAAAGAAGG - Intronic
1097285059 12:57870709-57870731 ACTGGAAAATGAAGGAACCAGGG - Intergenic
1097316820 12:58180558-58180580 TCTGGAGAATGAAGGAGGGTGGG + Intergenic
1097653809 12:62337227-62337249 TCTGAAAAATGAATGAAGGAAGG - Intronic
1097791941 12:63824521-63824543 TCTCAAAAAAGAAGGAAGGAAGG + Intergenic
1098125796 12:67291655-67291677 TCTGTACATTGAAGATAGGAAGG + Intronic
1098338074 12:69423979-69424001 TCTAGAAAGAGAAGGAAGCAAGG - Intergenic
1098469711 12:70829194-70829216 CTTGAAAATTGAAGGAAAGAAGG + Intronic
1098589963 12:72199365-72199387 TTTGGAAATAAAAGGAAAGAGGG + Intronic
1098698876 12:73597078-73597100 CGTGGAAGTTGAAGGAAAGAAGG + Intergenic
1098853065 12:75620456-75620478 TGCGGAGAGTGAAGGAAGGAAGG + Intergenic
1099568293 12:84280099-84280121 TCTGGTAATAGAAAGCAGGATGG + Intergenic
1099972657 12:89515925-89515947 AGGGGAATTTGAAGGAAGGAGGG - Intronic
1100713333 12:97280372-97280394 TCTGGAAATTTAATAAAGGATGG - Intergenic
1101440251 12:104698621-104698643 GCTGGTAAGTGCAGGAAGGAAGG - Intronic
1102203016 12:111070444-111070466 TCTTGAAAAAGAAGGAAGGAAGG - Intronic
1102315194 12:111881978-111882000 TCTGGAAAGTGAGGGATTGAAGG + Intronic
1102926247 12:116828626-116828648 TCCAGAAATGGAAGCAAGGATGG + Intronic
1104250456 12:127088659-127088681 TTTGGAAAAGGAAGAAAGGACGG + Intergenic
1104857801 12:131910038-131910060 TCAGCAAATGCAAGGAAGGAGGG - Intronic
1105577415 13:21667134-21667156 AAAGGAAAGTGAAGGAAGGAAGG - Intergenic
1105642657 13:22281544-22281566 ACTGAAAATTGAAAAAAGGAAGG + Intergenic
1106491317 13:30225271-30225293 TCTGGAACTTGAAGTCAGTAAGG - Intronic
1107348114 13:39484920-39484942 TCTGGCTATTCAAGGAAGGGGGG - Intronic
1107837665 13:44424732-44424754 TCAGAAAAAAGAAGGAAGGAAGG - Intergenic
1107969923 13:45631570-45631592 GTTGGAAATGGAAGGAAGGTGGG - Intergenic
1108497921 13:51043358-51043380 TGTTGAATCTGAAGGAAGGATGG - Intergenic
1108847700 13:54696508-54696530 TCTGGAAGTCAAAGGGAGGAAGG - Intergenic
1108948986 13:56063268-56063290 GATGGAAAAGGAAGGAAGGAAGG + Intergenic
1109799587 13:67358726-67358748 TTTAAAAATGGAAGGAAGGAAGG - Intergenic
1109888335 13:68573550-68573572 TATGGTAATTGAAAGAAAGAGGG + Intergenic
1110303658 13:73958741-73958763 TCTGGAAATTGAAAGGTGGCGGG + Intronic
1110548229 13:76780987-76781009 TCTGTAAAGTGAATGAAGGAGGG + Intergenic
1110706429 13:78605285-78605307 TCTGGAGCTAGAAGGAAGGGAGG - Intergenic
1110781106 13:79465923-79465945 CCTGGGGATGGAAGGAAGGAAGG - Intergenic
1111203360 13:84969628-84969650 GCTGGGAAGGGAAGGAAGGAAGG - Intergenic
1111275378 13:85939296-85939318 TCTGGAAGTTCAAGGGAGGAAGG + Intergenic
1112379508 13:98875384-98875406 TTTTGAAAGTGAAAGAAGGAGGG - Intronic
1112404573 13:99107770-99107792 TCTGAAGAAGGAAGGAAGGAAGG + Intergenic
1113029593 13:105978390-105978412 TCTGGAAATTGGCTGTAGGAGGG + Intergenic
1113345637 13:109475362-109475384 GAGAGAAATTGAAGGAAGGAAGG + Intergenic
1113684133 13:112268996-112269018 TGTGGAATTTGAAGAAAGTATGG - Intergenic
1113814107 13:113159736-113159758 TCAGGAAAGTGGAGGAGGGAGGG - Intronic
1114243810 14:20893876-20893898 TCTGGTACCTGAAGCAAGGAAGG - Intergenic
1114486604 14:23066494-23066516 TCTGGCCATTGAAGAAAGGAGGG - Intronic
1114737480 14:25057400-25057422 CCTGGAAATTGGAGTAAGAAAGG - Intergenic
1115438443 14:33403841-33403863 TTTGTAAAAGGAAGGAAGGAAGG - Intronic
1115492146 14:33967895-33967917 TCAGGAAGGGGAAGGAAGGAAGG + Intronic
1117225678 14:53656114-53656136 TCTGGAAGGCAAAGGAAGGATGG - Intergenic
1117357843 14:54943184-54943206 TCTGCCATGTGAAGGAAGGAAGG - Intronic
1117707069 14:58481464-58481486 TCTGAAACTAGAAGGAAGGGAGG + Intronic
1118623177 14:67632741-67632763 TTATGAAATAGAAGGAAGGAAGG + Intronic
1119203025 14:72772433-72772455 TAGGGAAATTGCAGGAAGAAGGG + Intronic
1119794113 14:77380325-77380347 ACTGCAAATAGAAGGAAGAAAGG - Intronic
1120304783 14:82755507-82755529 GCTGGAAAGAAAAGGAAGGAAGG + Intergenic
1120751225 14:88200159-88200181 TCTAAAAAAAGAAGGAAGGAAGG - Intronic
1120758803 14:88268116-88268138 CCTGGAAAAGGAAGGAAAGAAGG + Intronic
1120923122 14:89772878-89772900 TCTAAAAAAGGAAGGAAGGAAGG - Intergenic
1121917042 14:97844710-97844732 TTTGTAAAAGGAAGGAAGGAGGG + Intergenic
1122424838 14:101599828-101599850 TCTGAGGATTGAAGGAAGGGAGG - Intergenic
1122811422 14:104291275-104291297 TCTGGCACTTGAAGGCAGGGTGG - Intergenic
1123150113 14:106172758-106172780 TATGGACAGTCAAGGAAGGAAGG + Intergenic
1123196395 14:106620776-106620798 TATGGACAGTGAGGGAAGGAAGG + Intergenic
1123424168 15:20155746-20155768 GCTGGAAATTCCTGGAAGGATGG + Intergenic
1123533388 15:21162275-21162297 GCTGGAAATTCCTGGAAGGATGG + Intergenic
1125300714 15:38252015-38252037 TTTGGGAAATGAAGGGAGGAGGG + Intergenic
1125310658 15:38374959-38374981 CTTGGAAATTGCATGAAGGAAGG - Intergenic
1125499100 15:40227115-40227137 TCTTGAAATTAAAGTGAGGATGG + Intergenic
1125579453 15:40775258-40775280 TTGGGAACTTGAAGGCAGGATGG + Intronic
1126000463 15:44205009-44205031 TCTCGAAAAAAAAGGAAGGAAGG + Intergenic
1126239207 15:46421922-46421944 TCTGGAAAGTGAAGGGACTAAGG + Intergenic
1126320929 15:47422221-47422243 TAAGAAAATGGAAGGAAGGAAGG - Intronic
1126643903 15:50855762-50855784 TGTGGAAATTGAAAGGATGAAGG - Intergenic
1126796285 15:52262595-52262617 TCTGGACACTGCAGGCAGGATGG + Intronic
1127210065 15:56764918-56764940 TCTGAAACTTGTAGGAAAGATGG + Intronic
1127392826 15:58520916-58520938 TCTAGAAAAGGAAGGGAGGAGGG + Intronic
1128296499 15:66525130-66525152 GTAGGAAATTGAAGGAACGATGG - Intronic
1128462623 15:67882752-67882774 CCTAGAACTGGAAGGAAGGAAGG - Intergenic
1128552212 15:68605643-68605665 ACTGGAAAGTGAAGGGAGAATGG + Intronic
1129084630 15:73075857-73075879 TCTGGAAAAGAGAGGAAGGAAGG - Intronic
1129181815 15:73882481-73882503 TCTGGGCCTTGAAGGAAGGGTGG - Intronic
1129952877 15:79607398-79607420 ACAGGAAAGTGAAGGAAGCATGG - Intergenic
1130114953 15:80998757-80998779 TCTGAAAAATGAAGCAGGGAAGG + Intergenic
1130684505 15:86024947-86024969 TCTGGCAATTGAGTGAAGGTGGG + Intergenic
1130778235 15:87008012-87008034 TCTGGTGAGTGAAGGAGGGAAGG + Intronic
1131168043 15:90156794-90156816 TCTCAAAAAGGAAGGAAGGAAGG + Intergenic
1131428256 15:92365112-92365134 TCTGCAAATAGAAGAAAGCAAGG - Intergenic
1132042048 15:98533399-98533421 GCAGGACCTTGAAGGAAGGAAGG + Intergenic
1132161837 15:99549844-99549866 TCAGGGAAATGTAGGAAGGAAGG - Intergenic
1132611728 16:820195-820217 TCTAAAAAAGGAAGGAAGGAAGG - Intergenic
1133659096 16:7897471-7897493 TCTTAAAAATGAAAGAAGGAGGG - Intergenic
1133816297 16:9199953-9199975 GAAGGAAAATGAAGGAAGGAGGG - Intergenic
1134685628 16:16156247-16156269 TCTGGCAATTAAGGGAAGCAAGG + Intronic
1135344339 16:21675767-21675789 TCTGGAAGTTCAAGAAAGTAGGG - Intergenic
1136599276 16:31273572-31273594 TTTGCAAATTGAAGGGAGGATGG - Intronic
1136679941 16:31954032-31954054 TATGGACAGTCAAGGAAGGAAGG - Intergenic
1136780287 16:32895576-32895598 TATGGACAGTCAAGGAAGGAAGG - Intergenic
1136890121 16:33964068-33964090 TATGGACAGTCAAGGAAGGAAGG + Intergenic
1137488291 16:48909666-48909688 TCTGGAAAGAGAGGGAAGGAGGG + Intergenic
1137955825 16:52827982-52828004 TTTGGAAATTGAAAGGAGTAAGG - Intergenic
1138077103 16:54053384-54053406 TTTGGAAACTGAAAGAGGGAGGG - Intronic
1138087078 16:54142904-54142926 TGTGGAAGCTGAAGGAAAGAAGG + Intergenic
1138311011 16:56024139-56024161 TCTGGAAACTGAGGTAAAGATGG - Intergenic
1138560454 16:57798015-57798037 TCTGGTATCTGGAGGAAGGAAGG + Intronic
1138697797 16:58831861-58831883 TCTCGAAAAGGAAGGAGGGAAGG - Intergenic
1139270795 16:65680918-65680940 TCTAGAAATGGATGGAAGCAAGG - Intergenic
1139842933 16:69896415-69896437 TCAAGAAATTGCAGTAAGGATGG - Intronic
1140736889 16:77906556-77906578 TCTGGAAAATGAAGGAAGGATGG + Intronic
1140862301 16:79028566-79028588 GCTGGAAAGGGAGGGAAGGAAGG - Intronic
1141122561 16:81371869-81371891 TCTGGAAACTGAAGAAAAGCAGG - Intronic
1141339266 16:83188003-83188025 TCTAGAAACTGTAGGAAGGCTGG + Intronic
1203082911 16_KI270728v1_random:1159546-1159568 TATGGACAGTCAAGGAAGGAAGG - Intergenic
1143043161 17:4054763-4054785 TCTGGAAGTTGAGGAAAGAATGG + Intronic
1143094704 17:4472193-4472215 TGTGGAAAAGGAAAGAAGGAAGG - Intronic
1143966956 17:10762330-10762352 ACAGGAAACTGAAGGCAGGAGGG - Intergenic
1144025431 17:11272528-11272550 TCAGGAAACTGAAGCACGGAAGG - Intronic
1145061252 17:19735691-19735713 TCTTGAACTTGAAGGAAAGCTGG + Intergenic
1146820921 17:35983076-35983098 TCAGGAAATGGATGGATGGATGG - Intergenic
1147253089 17:39165333-39165355 TCTGGAATGTGAAGGGAGGTGGG - Intronic
1148810317 17:50286168-50286190 TCTGAAAAAAGAAAGAAGGAAGG - Intergenic
1149142113 17:53443861-53443883 TCTGGAGGGTGAAGGATGGAAGG + Intergenic
1149428443 17:56577736-56577758 GCTGGAAGAAGAAGGAAGGAAGG - Intergenic
1149537858 17:57446282-57446304 TCAGGGAACAGAAGGAAGGAGGG + Intronic
1149707372 17:58707176-58707198 ACTGGAAACTGAAGGAAAGCTGG - Intronic
1150488225 17:65558736-65558758 TCTGGAAAGAAAAGGAAGGGGGG + Exonic
1150511622 17:65758505-65758527 AATGGAAAATGAAGGAATGAAGG - Intronic
1150597458 17:66618863-66618885 TGAGCAAATGGAAGGAAGGAAGG - Intronic
1151464165 17:74273887-74273909 TGCGGAAACTGAAGGAAGGCAGG + Intergenic
1153606637 18:6840270-6840292 TCTGGAAATAGAAGTGAGAAAGG - Intronic
1154033087 18:10770742-10770764 TCAGAAAAAGGAAGGAAGGAAGG - Intronic
1154999806 18:21675086-21675108 TCTGGGGATAGATGGAAGGAGGG - Intronic
1155096028 18:22557442-22557464 GCTGGAAATTGGGGGCAGGAGGG + Intergenic
1155380028 18:25210641-25210663 TTTGGAAAATGAAGCAAAGAAGG - Intronic
1155534961 18:26807725-26807747 ACTGTAAATTCAAGGAATGAGGG + Intergenic
1155741983 18:29299540-29299562 TCTGGAAATTGATTGAGGGGCGG + Intergenic
1155839658 18:30629976-30629998 TCTGGAAATCAAAGGAAGAAAGG - Intergenic
1156295531 18:35786209-35786231 TCTGGAAATTTATAAAAGGAAGG + Intergenic
1156305438 18:35874483-35874505 TCTAGAAATGGAAGGAAGGAGGG + Intergenic
1156369287 18:36458215-36458237 TCTGGTTGGTGAAGGAAGGAAGG + Intronic
1156409423 18:36813444-36813466 ACTGAGAAATGAAGGAAGGATGG + Intronic
1156843739 18:41639090-41639112 ACAGGAAAAAGAAGGAAGGAAGG + Intergenic
1157110462 18:44815909-44815931 TCTGGACATTGAAGCTGGGAGGG - Intronic
1158251382 18:55491519-55491541 ACTGGATTTTGAAGGAAAGATGG - Intronic
1158895549 18:61909470-61909492 TCTTGAGATTGAAGGCAGGATGG + Intergenic
1158974280 18:62696744-62696766 TCTGGGAAGGGAGGGAAGGATGG - Intergenic
1159668228 18:71190290-71190312 ACTGAAAATTTAAGGAAGGTAGG + Intergenic
1159933101 18:74334502-74334524 TCTGGGAATGAAAGGAAGGCAGG + Intronic
1159969617 18:74633393-74633415 TCCGGAAATGGAAGGATTGAAGG + Exonic
1161657411 19:5524754-5524776 TTGGGAAATGGAAGGAAGGATGG - Intergenic
1161848526 19:6726269-6726291 TCTGGGAATGAGAGGAAGGAAGG - Intronic
1162588371 19:11575363-11575385 TCAGGAAATTGAAGCCAGGAGGG - Intronic
1162861644 19:13510012-13510034 TCTACAAAAGGAAGGAAGGAAGG + Intronic
1162863638 19:13527115-13527137 TCTTGAGCTGGAAGGAAGGAAGG - Intronic
1163488688 19:17604947-17604969 TCTGGAAAAGGAAGAAGGGATGG + Exonic
1163493499 19:17631087-17631109 TCTGAAGAAGGAAGGAAGGAAGG - Intronic
1164187204 19:22880720-22880742 TCTGAAAATTGAAAGAAGGAAGG + Intergenic
1164433241 19:28206799-28206821 TCAGGTAAAGGAAGGAAGGAAGG + Intergenic
1166289099 19:41850434-41850456 GCAGGAAACTGAAGGAAGCAGGG + Intronic
1166500885 19:43340400-43340422 TCTGGAAAGAAAAGAAAGGAAGG - Intergenic
1167041479 19:47025249-47025271 TGTGGCAGTTGAGGGAAGGAGGG + Intronic
1168465349 19:56596883-56596905 AATGGAAATGGAAGAAAGGAAGG + Intronic
1168543545 19:57231809-57231831 TCTGGAAAAGGAAGGAAGGTGGG + Intronic
925189045 2:1868430-1868452 TCTAGAAGAGGAAGGAAGGAAGG + Intronic
926178344 2:10617112-10617134 TGTGGAAACTGAAGGAGAGAAGG + Intronic
926702836 2:15815307-15815329 TGAGGAAACAGAAGGAAGGAGGG - Intergenic
927338926 2:21958158-21958180 TGTGGAAAGAGAAGAAAGGAAGG - Intergenic
927976187 2:27340136-27340158 TTTGGGAATTGAAGGGAGGGAGG - Intronic
928056351 2:28059287-28059309 TCAGAAAAATGAAGGAAAGAGGG - Intronic
928577335 2:32668581-32668603 TTTAAAAATGGAAGGAAGGAAGG - Intronic
928736644 2:34299126-34299148 TGTGGAAGTTGGTGGAAGGAAGG + Intergenic
929094556 2:38251113-38251135 TATGGAAATGAAAGGGAGGAAGG + Intergenic
929393452 2:41496812-41496834 TCTGGAAATTGAAGGAAGGAGGG + Intergenic
929682740 2:44007822-44007844 TGTGGAAATTGAAGAAACTAAGG - Intergenic
930496718 2:52154751-52154773 TCAGGAGTTTGAAGGATGGAGGG + Intergenic
930649131 2:53946904-53946926 CCTGAAAAAGGAAGGAAGGAAGG + Intronic
930863882 2:56104204-56104226 TTTGTCAAATGAAGGAAGGAAGG + Intergenic
930951113 2:57145494-57145516 GCTGGAAATTCAAGCCAGGAAGG - Intergenic
931070321 2:58640295-58640317 GCTTGAATATGAAGGAAGGAGGG - Intergenic
931608340 2:64074320-64074342 TTTGGAGATTAAAGGAAAGATGG + Intergenic
932071144 2:68621684-68621706 TCAAAAAAATGAAGGAAGGAGGG + Intronic
932197322 2:69795994-69796016 TCTGGAAATTGAAGGAAGGAGGG - Intronic
932631228 2:73345035-73345057 TCTCAAAAAGGAAGGAAGGAAGG - Intergenic
933204098 2:79484959-79484981 TCTGGAAAATGAAGTATGGCTGG - Intronic
933351153 2:81153579-81153601 TCTTGAAATTTGAGGGAGGAAGG - Intergenic
933413394 2:81952767-81952789 TTTGGAAATGGAGGGAAAGAGGG + Intergenic
933588496 2:84205834-84205856 ACTGGGAAATGGAGGAAGGAGGG + Intergenic
933754400 2:85626531-85626553 TCTGGAACTTCAGGGAATGAGGG + Intronic
934218980 2:90064269-90064291 TCTGGCACTTGAAGAAAAGAAGG + Intergenic
935821796 2:106900580-106900602 TCCTGAATTTGGAGGAAGGAGGG + Intergenic
936342745 2:111650791-111650813 TCTGGAAATAGAAGTGATGATGG + Intergenic
936383645 2:112010143-112010165 TCTTGAAAGTGAAGCCAGGAAGG + Intronic
937184673 2:120029050-120029072 TTTGGCAATAGATGGAAGGAAGG + Intronic
937625100 2:124035021-124035043 TCTGAAGAAGGAAGGAAGGAAGG - Intronic
938010093 2:127821915-127821937 TCTGGAAATCGAAGGAAGGAGGG + Intergenic
938659998 2:133476556-133476578 CCTGAAAAGTGAAGGCAGGAAGG - Intronic
939466666 2:142564917-142564939 TCTGGAAATTGAAGGCAAATTGG + Intergenic
939698766 2:145362647-145362669 TATAGAAATTGAAGGAGGCATGG + Intergenic
939988555 2:148855779-148855801 TCTGGCATTAGAAGTAAGGAAGG - Intergenic
940072562 2:149705325-149705347 GCTGGGAAGGGAAGGAAGGAGGG - Intergenic
940405304 2:153294292-153294314 TGTGAAACTTGAAGGAAGCAAGG - Intergenic
940832423 2:158482314-158482336 TCTTGGAAAGGAAGGAAGGAAGG - Intronic
940989852 2:160086125-160086147 TCTGGAAATTGAAGGAAGGAGGG - Intergenic
941395826 2:164971593-164971615 TGAGGAAATTGATGGATGGAAGG - Intergenic
941600048 2:167531337-167531359 TCAGGAAATTAAATGAAGGACGG + Intergenic
942482362 2:176403024-176403046 TATAAAAATGGAAGGAAGGAAGG - Intergenic
942610294 2:177736173-177736195 TCTAGAACCAGAAGGAAGGAAGG + Intronic
942610598 2:177738378-177738400 GCAGGAAAGTGATGGAAGGAAGG + Intronic
943441344 2:187931816-187931838 TCAGGAACTTGAAGGGAGGAAGG - Intergenic
943721879 2:191213107-191213129 TCTGAATATTGAAGAAGGGATGG - Intergenic
945318161 2:208392778-208392800 TCTGAAAATTGAAGGAAGGAAGG - Intronic
945616335 2:212073096-212073118 CCTGGAGGTGGAAGGAAGGAAGG + Intronic
945746590 2:213725906-213725928 TCAGGACATTGAAAGAAGGCAGG + Intronic
946960963 2:224985514-224985536 ATAGGAAATGGAAGGAAGGATGG + Intronic
948570941 2:238916762-238916784 TCTGGGACTAGAAGGAAGGTGGG + Intergenic
948733918 2:239986259-239986281 ATTTGAACTTGAAGGAAGGAAGG - Intronic
1171424166 20:25039167-25039189 TCAGGAAAGTGAAGAAGGGAAGG - Intronic
1172204598 20:33153951-33153973 TATGGAAAGAGAAGGAAAGAAGG + Intergenic
1172586261 20:36087315-36087337 TCTGAAATTTGAATAAAGGAAGG + Intergenic
1173053599 20:39589453-39589475 TCGGGACATTCATGGAAGGAGGG + Intergenic
1173203019 20:40967904-40967926 TCTGGAAGCTGGAGAAAGGAAGG - Intergenic
1173901843 20:46596081-46596103 CCTGGATGTTGAATGAAGGAGGG + Intronic
1173964292 20:47100106-47100128 TTTGTTAAATGAAGGAAGGAAGG + Intronic
1174006603 20:47415982-47416004 TCTGTGAAAGGAAGGAAGGAAGG + Intergenic
1174221575 20:48959609-48959631 TCTCAAAATGGAAGGAAGGAAGG - Intronic
1174274168 20:49391572-49391594 TCCAGAAAGGGAAGGAAGGAAGG - Intronic
1174560374 20:51426734-51426756 TCTGGAGTTAGAAGGCAGGATGG + Intronic
1174569230 20:51489276-51489298 ACTGGAATTCCAAGGAAGGAGGG - Intronic
1175544977 20:59772357-59772379 TGGGGAAACTGTAGGAAGGAAGG + Intronic
1175659658 20:60801782-60801804 TCTGCAAATGGAAGCAAAGATGG - Intergenic
1177035963 21:16043223-16043245 TTATGACATTGAAGGAAGGAGGG - Intergenic
1177245260 21:18515072-18515094 TATGGTAATTGAAGTCAGGAAGG + Intergenic
1177485459 21:21749523-21749545 AGTGGAAATTAAAGAAAGGAGGG - Intergenic
1177913257 21:27056797-27056819 TCAGGAACTTGCAAGAAGGATGG + Intergenic
1177933909 21:27318470-27318492 TCTGGAAATTGATTGAGGGCTGG + Intergenic
1178689670 21:34740583-34740605 TATGTAAATTGATGGATGGATGG - Intergenic
1179222202 21:39418272-39418294 ACTGGTAAGTGAAGAAAGGAAGG - Intronic
1179567405 21:42257989-42258011 TGGGGAAATGGGAGGAAGGATGG - Intronic
1179567451 21:42258185-42258207 TGGGGAAATGGGAGGAAGGATGG - Intronic
1179903524 21:44407146-44407168 TCAAAAAATGGAAGGAAGGAAGG - Intronic
1181185379 22:21099672-21099694 TCAGGAAATGGAAGAATGGATGG - Intergenic
1181917354 22:26291970-26291992 TCAGGAAAAGGAAGGAAGGAAGG + Intronic
1182081631 22:27533408-27533430 ACTGGAAACTGAAGGAATGGGGG - Intergenic
1183364497 22:37399864-37399886 CCTGGTAAATGAAAGAAGGAAGG + Intronic
1183796312 22:40121250-40121272 TCTGGCTATACAAGGAAGGAAGG - Intronic
1183847240 22:40552367-40552389 TCTGGAAATGGAAGAAAAAATGG + Exonic
1184271354 22:43386082-43386104 GCTGGAAAATGATGGAAGCAGGG + Intergenic
1184527522 22:45034228-45034250 TCTGGAAATAGAAGGGATGATGG + Intergenic
1185169950 22:49286980-49287002 TCTGGGAACAGAAGGAAGGCAGG - Intergenic
949275393 3:2274034-2274056 TCTGTAGATTGAAGAAAGAATGG - Intronic
949941037 3:9154544-9154566 ACTGGGAATTGAAGGAAGGATGG - Intronic
950222517 3:11207012-11207034 TCTGAGAGTTGAAGGACGGATGG + Intronic
950449932 3:13059749-13059771 TCTAAAAAATGAAAGAAGGAAGG + Intronic
950611658 3:14130902-14130924 TCCGGAGAATGAAGGAAGGCTGG + Exonic
951750819 3:26034323-26034345 ACTGTAAATTGTATGAAGGAAGG + Intergenic
952142760 3:30498258-30498280 TCTGTGAAGTGAATGAAGGATGG - Intergenic
952373982 3:32749880-32749902 TATGGAAATAAAATGAAGGAAGG + Intronic
953034498 3:39200450-39200472 GCTGGATATTAAAGGAGGGAGGG - Intergenic
953807025 3:46079487-46079509 GCTGGAAGTGGAAGGGAGGAGGG - Intergenic
954999092 3:54910249-54910271 TCTGGAAGTTGGTGGAAGAATGG - Intronic
955168594 3:56540514-56540536 ACTGGAAAGTGAAGGGAAGAAGG - Intergenic
955805174 3:62726153-62726175 TTGGGTAATTGAAGGATGGAGGG + Intronic
956557618 3:70540368-70540390 TCTGGAAGTCAAAGGGAGGAAGG - Intergenic
957016755 3:75073665-75073687 TCAGGAATTTGATGGAAGGCTGG - Intergenic
957352403 3:79042471-79042493 TCAGGAAATAGAAGGAACCAGGG - Intronic
957624926 3:82644302-82644324 TCTGGAAGTCAAAGGGAGGAAGG + Intergenic
957943429 3:87034156-87034178 TCTAGAAATGGAAAGAAGCAAGG + Intergenic
958962571 3:100523880-100523902 TGTGCTAATTGAATGAAGGAAGG + Intronic
959163311 3:102744689-102744711 TCTGTCAATGGAAAGAAGGAAGG + Intergenic
959246190 3:103872140-103872162 GCTGGAAAGTGTAGCAAGGAGGG + Intergenic
959283164 3:104373223-104373245 TCTGAAACTTGAAGAAGGGATGG - Intergenic
960202904 3:114859440-114859462 CCACCAAATTGAAGGAAGGAAGG - Intronic
960311190 3:116118306-116118328 ACTGGAAATAGGGGGAAGGAAGG - Intronic
960911176 3:122650779-122650801 TCAGAGAAATGAAGGAAGGAAGG - Intergenic
960951028 3:122998520-122998542 TCTGGAAATGGACGGAAGGCTGG + Intronic
961178166 3:124853182-124853204 GCTGGAAACTGAAAGAAAGAAGG + Intronic
961414516 3:126747751-126747773 TCTGGAAATGAAGGGAAGGAGGG - Intronic
961627216 3:128272404-128272426 ACTGGACATTGAAGGGAGGAAGG + Intronic
961783771 3:129337286-129337308 TCTGGTTATTGAATAAAGGAAGG - Intergenic
962893309 3:139692095-139692117 TGTGGAAATGAAAGAAAGGAGGG - Intergenic
962988481 3:140557535-140557557 TCTGCAAACTGAAGAAAGGTCGG + Intronic
963049049 3:141126483-141126505 GTTGGAAATTGAAGGAAAGTGGG - Intronic
965045936 3:163576646-163576668 AATAGAAAATGAAGGAAGGAAGG - Intergenic
966050898 3:175617253-175617275 TCTGGAGGTCGAAGGAAGGAAGG - Intronic
966120202 3:176512116-176512138 TCTGGAAATTGAAGGAAGGAAGG - Intergenic
966144997 3:176800949-176800971 TCAGAAAAAAGAAGGAAGGAAGG + Intergenic
966688680 3:182722868-182722890 TCTGGAAATTGAAGGGAGGAGGG - Intergenic
966959267 3:184917428-184917450 TCTCAAAAATGAAGGAAGGAGGG - Intronic
967115321 3:186332374-186332396 AGTGGAAATTTAAGGAAGCAGGG + Intronic
967300432 3:188007065-188007087 TCGGGGAATGGAAGAAAGGAAGG + Intergenic
967587054 3:191227462-191227484 TCTAGAAATAGGAGGAAGGCAGG - Intronic
967945196 3:194798536-194798558 GCTGGAAATAGAAGGCTGGAAGG - Intergenic
968192719 3:196682147-196682169 CCTGTAAATTAAAGAAAGGAGGG + Intronic
969966706 4:11003906-11003928 TCTGTAAAGGGAAGAAAGGAGGG + Intergenic
969967630 4:11013551-11013573 TCTGGACATAGAGGGAATGAAGG + Intergenic
969977075 4:11114631-11114653 TATGGAAAATGGAGGAAGGAAGG - Intergenic
970387888 4:15574426-15574448 AATGGAGATTGAAGTAAGGAAGG - Intronic
970398177 4:15692181-15692203 TTTGGAAACTAAAGGAAAGAGGG - Intronic
971111966 4:23595508-23595530 TCTGTACATTAAAAGAAGGAAGG + Intergenic
971336964 4:25732066-25732088 TCTGTGAAAGGAAGGAAGGAAGG + Intergenic
971546083 4:27889408-27889430 TCTTGAAGTGAAAGGAAGGAAGG - Intergenic
971833536 4:31731840-31731862 TTTAGAAAAGGAAGGAAGGAAGG - Intergenic
971859828 4:32088873-32088895 TCTGGAAAATGAAGGGAAGAAGG - Intergenic
971868529 4:32205095-32205117 TGTGGAACTTAAAGGAAAGATGG + Intergenic
971932393 4:33101843-33101865 GAAGGAAATGGAAGGAAGGAAGG - Intergenic
972581572 4:40399945-40399967 TCTGGGACTTAAAGCAAGGATGG + Intergenic
972870330 4:43290004-43290026 TGTGAAAGTAGAAGGAAGGAAGG + Intergenic
972937102 4:44150130-44150152 AATGGAATTTGCAGGAAGGAAGG + Intergenic
973118221 4:46487494-46487516 TCTGGAAATCGATTGAGGGACGG - Intergenic
973835374 4:54804078-54804100 CCTGGAAATTGAAGGCAAAATGG + Intergenic
973994190 4:56439998-56440020 TATGGACAATGAAGGGAGGAAGG - Intronic
974159633 4:58121179-58121201 TTTGGAAATTGATGGAAATAGGG + Intergenic
975029663 4:69599766-69599788 CCTGGGAAAGGAAGGAAGGAGGG + Intronic
975182078 4:71357928-71357950 TATGGAAAATGAAGGTATGAAGG + Intronic
975226534 4:71878743-71878765 TCTCTGAATGGAAGGAAGGAAGG - Intergenic
975604320 4:76138394-76138416 TCAGGAAATTTAAGGGAGAAGGG - Intronic
975697653 4:77029691-77029713 TCTGGCCCTTGAGGGAAGGAAGG - Intronic
976001905 4:80384649-80384671 GAGGTAAATTGAAGGAAGGAAGG + Intronic
976572685 4:86632050-86632072 TCTGGTGATATAAGGAAGGATGG - Intronic
976638665 4:87313666-87313688 TCTTGAAATTAAAGGAATAAAGG - Intronic
977223745 4:94370196-94370218 TGTGCAAAAGGAAGGAAGGAAGG + Intergenic
977287041 4:95120808-95120830 TCTTGAAAAGGAAGTAAGGAAGG - Intronic
977724137 4:100275161-100275183 TGTGGAAGTTGATGGAGGGAAGG - Intergenic
978471534 4:109073036-109073058 TCTGGAAACTGAAGGAATAATGG - Intronic
978728577 4:111999139-111999161 TCTGTTTTTTGAAGGAAGGAAGG + Intergenic
978819908 4:112954262-112954284 TATTGAAAAGGAAGGAAGGAAGG - Intronic
979267972 4:118725547-118725569 TATGGAAATTAATGGAAAGAAGG + Intronic
979280820 4:118865689-118865711 TTTGGAAACAGGAGGAAGGAGGG + Intronic
981006273 4:139878654-139878676 TCTGGAAATGGAATGAAGTTGGG + Intronic
981427880 4:144624688-144624710 TCTGGCTATTGAAGGCTGGATGG - Intergenic
981449249 4:144877288-144877310 TCTACAAATGGAAGGAAAGAAGG - Intergenic
981496425 4:145398601-145398623 TCTGGAAATTGATGGTAGTATGG - Intergenic
981620797 4:146696466-146696488 TTTAAAAAATGAAGGAAGGAAGG - Intergenic
983028171 4:162763668-162763690 TCTGGAACTTCTATGAAGGAAGG + Intergenic
983062455 4:163174815-163174837 TCTGGAAATTGAAGGGAGGAGGG + Intergenic
983309515 4:166041009-166041031 TGTGGAAAGATAAGGAAGGAAGG + Intronic
983412471 4:167418110-167418132 TCTGGAGACTGAAGGAGGGAAGG + Intergenic
983461022 4:168026443-168026465 TCTGGAAACTGAAGCAAGGAGGG - Intergenic
983871329 4:172827934-172827956 TTTAGACATTGAAGGAAGAAAGG + Intronic
984073098 4:175140757-175140779 TCTGGAGGTTGAAGGGAGGAAGG + Intergenic
984443720 4:179806342-179806364 ACTGAAAATTGGTGGAAGGAAGG + Intergenic
984563671 4:181301578-181301600 TTTGGGAAGGGAAGGAAGGACGG + Intergenic
985613032 5:900793-900815 TCTGGAGATGGGAGGAGGGAAGG + Intronic
987621304 5:20340695-20340717 TCTGGAGGTTGAAGGGAGGAAGG + Intronic
987733194 5:21803813-21803835 TGGGGAAAATAAAGGAAGGATGG + Intronic
988708810 5:33753324-33753346 TCTGGAACAGGAAGGAAGAACGG + Intronic
988877986 5:35469280-35469302 TCTCCAAATTGAAGGAATGGTGG - Intergenic
989449823 5:41573506-41573528 TCTGAAAATGGAAGGAAGGAAGG + Intergenic
990991057 5:61684455-61684477 TTTGGAATTTGAATGAAGAATGG + Intronic
992145524 5:73843395-73843417 TCTGAAAAATGTAGGAATGAAGG + Intronic
992466555 5:77011888-77011910 TCAGGAGAGAGAAGGAAGGAGGG - Intergenic
992946751 5:81818843-81818865 GCAGGAAAATGAAGCAAGGAAGG + Intergenic
993605480 5:89985811-89985833 TCTTGCAATGGAAGGAAAGAAGG + Intergenic
993845068 5:92931145-92931167 TCTTGAACATGAAGAAAGGAAGG + Intergenic
994169189 5:96640296-96640318 TCTAGAGATGGAAGGATGGATGG + Intronic
994349841 5:98732319-98732341 TTTTGAAATTGAGGGTAGGAAGG + Intergenic
995367847 5:111383991-111384013 TCTGGAAATTGAAGTGTGGTGGG + Intronic
995417259 5:111925131-111925153 TCTGGAAATTGAAGGAAGGAGGG - Intronic
995606704 5:113864655-113864677 TCTGGTAAAGGAAGAAAGGATGG - Intergenic
995715931 5:115081989-115082011 TCTGGAAATTGAAGGAAGGAAGG - Intergenic
995785225 5:115820483-115820505 TCTGGATAATGATGCAAGGAAGG - Intergenic
996129502 5:119764721-119764743 TCTTGAACTTAAAGGAATGAAGG + Intergenic
996207179 5:120755389-120755411 TCTGGAGACTGATGGGAGGAAGG - Intergenic
996510640 5:124312152-124312174 CCTTGAAAATGAAGGAAGGTGGG + Intergenic
997560873 5:134845385-134845407 TCTGGAAATTCACAGGAGGAAGG + Intronic
997664767 5:135620970-135620992 TCTGGAAGGAGAAGGAAGGGAGG - Intergenic
998806141 5:145919399-145919421 TATGTAAATTGAAAGAAGTAAGG - Intergenic
998852506 5:146364425-146364447 CCTGCAAAAAGAAGGAAGGAAGG - Intergenic
999216063 5:149936152-149936174 TCTAAAAAAGGAAGGAAGGAAGG + Intronic
999396969 5:151235667-151235689 TCTGAAAAAGGAAGGAAGGCAGG + Intronic
999472741 5:151870278-151870300 GGTGCAAATGGAAGGAAGGAAGG + Intronic
999865138 5:155693204-155693226 TCTGAAAATGAAAGGAGGGAGGG - Intergenic
999928904 5:156409238-156409260 TTTGGAAATTAAGGAAAGGAAGG - Intronic
1000115404 5:158149004-158149026 TATGGGAAAGGAAGGAAGGAAGG - Intergenic
1000147229 5:158465297-158465319 TTTTGAAAGTGAAGGAAGCAAGG - Intergenic
1000296668 5:159918069-159918091 TCTGGAAATAGAACCAGGGAAGG + Intronic
1000428080 5:161116092-161116114 AAGGGAAATGGAAGGAAGGAAGG + Intergenic
1002436989 5:179237744-179237766 TCTGGAAAATGGTGAAAGGAAGG + Intronic
1003194887 6:3905932-3905954 CCTGGAAATATAGGGAAGGAGGG + Intergenic
1003217620 6:4129117-4129139 TCTCAAAAAAGAAGGAAGGAAGG - Intronic
1003688739 6:8330759-8330781 TAAGGAAATGGAAGGAGGGAAGG + Intergenic
1004336677 6:14770461-14770483 TCTGTAGAAGGAAGGAAGGAAGG - Intergenic
1004544120 6:16580879-16580901 TCTACAGATTGAAGGAAGGGTGG + Intronic
1005784337 6:29227616-29227638 TCTGGAAAGTTGGGGAAGGAAGG - Intergenic
1005991874 6:30908307-30908329 CCTGGAGATTGAGGGAAAGATGG - Exonic
1006269122 6:32950485-32950507 TCTGGGGAGTGAAGGGAGGAGGG - Intronic
1006700204 6:35966298-35966320 TCTTCAAATTGAAGGAAGTTTGG - Intronic
1006935357 6:37713499-37713521 ACAGGAAATGGATGGAAGGATGG - Intergenic
1008931475 6:56944947-56944969 TGTCTAAATTCAAGGAAGGAAGG - Intronic
1009242709 6:61200590-61200612 TTTGGAAGTTGAAGGGAGGAAGG - Intergenic
1009694270 6:67079635-67079657 CCTGTAAACTTAAGGAAGGAAGG + Intergenic
1009783974 6:68307128-68307150 TCTGGAAGATTAGGGAAGGAAGG - Intergenic
1009827547 6:68885920-68885942 TATGAAAATGGAAAGAAGGAAGG + Intronic
1010350931 6:74873324-74873346 CCAGGAAACTGAAGGGAGGAAGG + Intergenic
1010574020 6:77510368-77510390 TCTGGAAATTGAAGGAAGAAAGG - Intergenic
1010651362 6:78458998-78459020 TTTGTCAATGGAAGGAAGGAAGG + Intergenic
1010800429 6:80168524-80168546 TATGGGAAAGGAAGGAAGGAAGG + Intronic
1011431537 6:87292757-87292779 TCTCTAAAATGAAGGAATGAAGG - Intronic
1011788522 6:90872551-90872573 ACTGGAAATTGGAGGGAAGAAGG - Intergenic
1011791586 6:90904689-90904711 TCTGGTCATTGTAGGAAGAATGG - Intergenic
1012676359 6:102118087-102118109 AATGGAAAAAGAAGGAAGGAAGG + Intergenic
1012805212 6:103884966-103884988 TCTAAAAATTAAAGGATGGAAGG - Intergenic
1014198357 6:118583261-118583283 TCTGGAAATTGAAGGAAGGAAGG + Intronic
1014558198 6:122858769-122858791 TGTGGTATTAGAAGGAAGGATGG + Intergenic
1015402872 6:132806615-132806637 ACTGGAAATTGAAGAAAGGAGGG - Intergenic
1015499703 6:133919736-133919758 GTTGGACCTTGAAGGAAGGATGG - Intergenic
1015762856 6:136683797-136683819 CCTGGAAACTTCAGGAAGGAGGG + Intronic
1015859925 6:137665131-137665153 TATAGAATTTGAAGGAAGGGTGG + Intergenic
1015881040 6:137870035-137870057 TCTGGCAAATGAAGGAGGAAAGG - Intronic
1015932157 6:138372063-138372085 TCTGGAAATTGAATGTAGGGGGG + Intergenic
1016209925 6:141519104-141519126 TGTGGAAATTAGAGCAAGGAGGG + Intergenic
1016275642 6:142349300-142349322 TGTGGAAAGTGAAGGAAGAATGG + Intronic
1017962779 6:159235877-159235899 TGTGGAAGTTGGAGGAAGGAAGG - Intronic
1018434825 6:163750580-163750602 TCTGGAGAATGAATGAGGGAAGG + Intergenic
1019149046 6:169992410-169992432 TCTGGGAAATGCAGGAAGGATGG + Intergenic
1019314000 7:376289-376311 GCTGGAAATGGAAGGAGGGGAGG + Intergenic
1019950668 7:4369764-4369786 TCTTAAAATTGAAGGAGGGCTGG - Intergenic
1020019079 7:4851537-4851559 ACTGGAAACTGGAGGAAGGAGGG + Intronic
1020599744 7:10257854-10257876 TCTGAAAATTGAAGTAAAGTGGG + Intergenic
1020697132 7:11426607-11426629 TCAGGAAATTTAAGAAAAGAAGG + Intronic
1021244487 7:18245049-18245071 TCTAGAAAATGGAGGAGGGATGG + Intronic
1021696367 7:23279901-23279923 TCTGCAAATTGGAGGCAAGAAGG + Intergenic
1021715881 7:23461755-23461777 TCCACAAATTGAAGGAAGGGTGG - Intronic
1021830007 7:24596776-24596798 TCTGGACATAGTAGGAAGCATGG + Intronic
1022667872 7:32428399-32428421 ACTGGAAATTGAGGGGAGGAAGG + Intergenic
1022826436 7:34019203-34019225 TTTGGAAGCTGAAGGAAGAAAGG - Intronic
1022918337 7:34984404-34984426 TCTGGAAACAGAAGAAAGAAGGG + Intronic
1023186179 7:37535688-37535710 TGTGAAAATTGAAGACAGGAAGG - Intergenic
1023481885 7:40643771-40643793 TCTGGAAATACTAGGAAGGGAGG + Intronic
1023825311 7:44004985-44005007 TTTGGAAATTGCGGGATGGAGGG - Intronic
1024526889 7:50356878-50356900 TCTGGATATGGAGGGAAGGGCGG + Intronic
1024740217 7:52345604-52345626 GATGAAAAATGAAGGAAGGAAGG + Intergenic
1025066972 7:55865410-55865432 TCTTGAAAATGAATGAAGCATGG + Intergenic
1025868238 7:65405959-65405981 TATAGAAATTGAAGAAAGGAGGG + Intergenic
1026088860 7:67283756-67283778 TTTGGAAATTGCGGGATGGAGGG - Intergenic
1026149189 7:67773683-67773705 GGAGGAAAATGAAGGAAGGAAGG - Intergenic
1026150850 7:67787109-67787131 TCTGAAGAAGGAAGGAAGGAAGG - Intergenic
1026240994 7:68575007-68575029 TCAGGAAATTAAAGGAACCAAGG + Intergenic
1026725394 7:72866591-72866613 TTTGGAAATTGCGGGATGGAGGG + Intergenic
1026728659 7:72892664-72892686 TCTCAAAATGGAAGGAAGGAAGG - Intronic
1027115116 7:75472803-75472825 TCTCAAAATGGAAGGAAGGAAGG + Intronic
1027118451 7:75499074-75499096 TTTGGAAATTGCGGGATGGAGGG - Intergenic
1027161453 7:75805544-75805566 TTTGGAGATTAAAGGAAAGATGG - Intergenic
1027224889 7:76237630-76237652 TCTGGAGAGTCAAGGAGGGAGGG + Intronic
1027273348 7:76536392-76536414 TTTGGAAATTGCAGGATGGAGGG + Intergenic
1027326793 7:77055456-77055478 TTTGGAAATTGCGGGATGGAGGG + Intergenic
1027715925 7:81669603-81669625 TCTGGAAAGAGAAAGAAAGAGGG - Intergenic
1028251576 7:88544680-88544702 TCTGGAAATTGAAGGAATGAAGG - Intergenic
1028419978 7:90621692-90621714 TGTGGCAAAGGAAGGAAGGAAGG - Intronic
1028742631 7:94293406-94293428 TCTGGGAAGAGAAAGAAGGAAGG - Intergenic
1028840240 7:95421640-95421662 TTGGGCAATTGAAAGAAGGAAGG + Intronic
1029186512 7:98742603-98742625 TTAGGGAATTGGAGGAAGGAAGG - Intergenic
1029201151 7:98840045-98840067 TCAGGAAAAGGAAGAAAGGAAGG + Intergenic
1029719038 7:102350946-102350968 TTTGGAAATTGCGGGATGGAGGG + Intergenic
1029722432 7:102377869-102377891 TCTCAAAAAGGAAGGAAGGAAGG - Intronic
1029753576 7:102558312-102558334 TTTGGAAATTGCGGGATGGAGGG - Intronic
1029771524 7:102657396-102657418 TTTGGAAATTGCGGGATGGAGGG - Intronic
1030000163 7:105051184-105051206 TCTAAAAAAGGAAGGAAGGAAGG - Intronic
1030265629 7:107618000-107618022 TTTGGTAAATGAAAGAAGGAAGG - Intronic
1030911684 7:115257806-115257828 TCTGGAACTTGAATGGGGGAAGG + Intergenic
1031273416 7:119685367-119685389 TATGGAAACTGAAGGAAAAAAGG + Intergenic
1031741434 7:125436567-125436589 TCAGGAAATGGCATGAAGGAAGG + Intergenic
1031999258 7:128254173-128254195 CCTGGAAGTGGAGGGAAGGATGG + Intronic
1032441704 7:131947269-131947291 TCTGGAGAAGGAAAGAAGGAGGG + Intergenic
1032545676 7:132739786-132739808 ACTTGAAAGAGAAGGAAGGAAGG + Intergenic
1032602675 7:133316272-133316294 TCTTCAAATGGAAGGAAGGAAGG - Intronic
1032673580 7:134107793-134107815 TCTGCAAAGTGAAAGAAGCAGGG + Intergenic
1032731147 7:134644225-134644247 TCTGGAGTTTGCTGGAAGGAGGG + Intergenic
1032996086 7:137448474-137448496 TTTAGAAATGGAGGGAAGGAAGG + Intronic
1033573431 7:142656681-142656703 TCTGGATGTTGAGGGAAGCAGGG - Intergenic
1033585807 7:142773548-142773570 TCTGGAAATTGTGGGATGGAGGG - Intergenic
1034343113 7:150370355-150370377 TTAGGACATTGCAGGAAGGAAGG - Intronic
1035183799 7:157110413-157110435 TCTGGAAACAGAAGGCAGGCAGG - Intergenic
1035884728 8:3279568-3279590 TTTGGAAATTCTAGGAAGAAGGG + Intronic
1036152658 8:6313079-6313101 TCTGGAAGCTGAAGAAAGCAAGG + Intergenic
1037268922 8:17103571-17103593 ACTGGAGAAGGAAGGAAGGAAGG + Intronic
1037561123 8:20075198-20075220 TCTGGAAGTTAAAGGCAAGATGG + Intergenic
1037667878 8:20986423-20986445 TCTGAAAAATGAAGAAAAGAAGG + Intergenic
1038383736 8:27121239-27121261 TCTGGAAATAGAAGAACCGAAGG + Intergenic
1038428403 8:27480411-27480433 TTTGGAGACTGAAGGAAGGAAGG + Intergenic
1038567910 8:28635146-28635168 AATGGAAACTGAAGCAAGGAAGG + Intronic
1039360062 8:36866444-36866466 TCTGGGATTGGAAGGCAGGAAGG - Intronic
1040095191 8:43435841-43435863 TCTGGAAATTGAAGAAAGGAAGG + Intergenic
1040396936 8:47009386-47009408 TCTGGAAATTGGAGGAAGAAAGG - Intergenic
1040960495 8:53027153-53027175 TCTGGAAAGGCAGGGAAGGATGG + Intergenic
1041092149 8:54312282-54312304 ACTGGAAATTGAAGAAAGAGGGG - Intergenic
1041667497 8:60459856-60459878 TAAGGAAAAGGAAGGAAGGAAGG - Intergenic
1042208167 8:66349796-66349818 TTTGGAAATTGAGAAAAGGATGG - Intergenic
1042286118 8:67112605-67112627 TCTGAGAATAGAAAGAAGGAGGG - Intronic
1042506410 8:69565644-69565666 TCTGGCAATTGAGTGAAGGGTGG - Intronic
1043322646 8:79009338-79009360 AGTGGACAGTGAAGGAAGGAAGG - Intergenic
1043322714 8:79009524-79009546 ACTGGAGAAAGAAGGAAGGAAGG - Intergenic
1043552410 8:81389706-81389728 TCAGGAAAGTAAAGGAGGGAGGG - Intergenic
1043734953 8:83730633-83730655 CCTGGAAGTTGAAGGAAGGAAGG - Intergenic
1043766040 8:84133499-84133521 TCTAGAAACTGAAAGAAGGAAGG + Intergenic
1044217286 8:89627066-89627088 TCGGGAAAATGGAGGAAGGAAGG - Intergenic
1044520054 8:93189012-93189034 GAAGGAAATGGAAGGAAGGAAGG + Intergenic
1045557567 8:103229483-103229505 TCTGCCAATGGAAGGAAGGAAGG - Exonic
1045971686 8:108085442-108085464 TCTGTAAATTTAACTAAGGAAGG - Intergenic
1046186139 8:110722208-110722230 TCTGGAAGTTGAAGAGAGAATGG - Intergenic
1046398351 8:113671252-113671274 TTTGAAAGATGAAGGAAGGAGGG - Intergenic
1046483917 8:114860265-114860287 TCTGGAACTAGAAAGAAGGTTGG - Intergenic
1047649904 8:126909408-126909430 TCTAGAAAAAAAAGGAAGGAAGG - Intergenic
1047684362 8:127289408-127289430 TCTAGAAATGGATGGAGGGATGG + Intergenic
1047848642 8:128831763-128831785 TTTTGAACTTGAAGGAAGAAGGG - Intergenic
1047855324 8:128902994-128903016 TGTGGTAGTAGAAGGAAGGAAGG + Intergenic
1047949620 8:129920931-129920953 TCTGTTAATTCAAGGAAGCAAGG - Intronic
1048365676 8:133736315-133736337 TTTAAAAATTAAAGGAAGGAAGG - Intergenic
1048440233 8:134454327-134454349 TCTGGACTTTGATGGAAGGCAGG + Intergenic
1048607563 8:135985361-135985383 GCTTGAAATTGCATGAAGGATGG - Intergenic
1049969197 9:806858-806880 TCTGGAACTTTAAGGAAGGAAGG - Intergenic
1050020584 9:1280265-1280287 TGTAGAAATTGGAGGAAGGCTGG + Intergenic
1050111112 9:2217374-2217396 GCGGGAAATTGAAACAAGGAAGG + Intergenic
1050180089 9:2912840-2912862 TAGGGAAAATGAAGGAAAGAAGG + Intergenic
1050627393 9:7519526-7519548 TTTGGAGATTGCAGGAAGGAGGG + Intergenic
1050656432 9:7833575-7833597 TCTGTAAATTCCAGGATGGAAGG - Intronic
1050716564 9:8534167-8534189 CCTGTAAAATGAAGGAAGCAAGG - Intronic
1050797813 9:9567151-9567173 GCTGAAATTTGAAGGAATGAAGG + Intronic
1051244942 9:15100677-15100699 GCTAGAAATAGAAGGAGGGAGGG + Intergenic
1051380466 9:16452818-16452840 ATTAGAAATTGCAGGAAGGAGGG - Intronic
1052439290 9:28473556-28473578 TCTGAAAAGGGAAGAAAGGAAGG - Intronic
1052886037 9:33649075-33649097 TCTGGATGTTGAGGGAAGCAGGG - Intergenic
1054776771 9:69130611-69130633 TCTGGAACTTGCATGACGGAAGG + Intronic
1055018559 9:71645125-71645147 AAAGGAAAATGAAGGAAGGAGGG - Intergenic
1055059652 9:72055424-72055446 TCTCGAAAAGGAAGGAAGGAAGG - Intronic
1057472613 9:95371280-95371302 TCTTAAAAAAGAAGGAAGGAAGG - Intergenic
1057790415 9:98120786-98120808 TCTGGAAGGAGAAGGAGGGAAGG - Intergenic
1058803704 9:108569375-108569397 TCTGGAAACTGGGCGAAGGAAGG + Intergenic
1059524831 9:114980991-114981013 TGTAGAAATTGAAGAAAGGCGGG + Intergenic
1059534688 9:115069855-115069877 TCTGGATAGAAAAGGAAGGAAGG - Intronic
1059903339 9:118953409-118953431 TCTAGAAAATGAAGGTAGGCCGG - Intergenic
1059997068 9:119921551-119921573 TCTGGTGATCCAAGGAAGGATGG - Intergenic
1060132800 9:121121274-121121296 TCTGCAAATTGAAAGAAAAATGG - Intronic
1060950922 9:127602171-127602193 TCTCAAAAAGGAAGGAAGGAAGG - Intergenic
1061933140 9:133843643-133843665 TGTGGTATGTGAAGGAAGGAGGG + Intronic
1062204344 9:135327536-135327558 GCTAGAGATTGAAGGAGGGAGGG + Intergenic
1062678920 9:137765811-137765833 TATAGAAATTGAAGGACAGATGG - Intronic
1203454590 Un_GL000219v1:153650-153672 TCTAGTCACTGAAGGAAGGAGGG + Intergenic
1185832485 X:3315460-3315482 TATGGACATTGAAGGTAGGATGG + Intronic
1186417796 X:9398739-9398761 TCTAAAAAATAAAGGAAGGAAGG + Intergenic
1186503004 X:10066852-10066874 TCTGGAAAATGAAAGGAGAAGGG + Intronic
1189741012 X:44117200-44117222 TCTGGAAACAGAGAGAAGGATGG - Intergenic
1189931136 X:46012386-46012408 TCTGGAAATTTCAGGAATCAAGG + Intergenic
1190866337 X:54387894-54387916 TATGTAAATTGAAGGCAAGAAGG - Intergenic
1190984772 X:55490181-55490203 TCTGGGAGTTGACGGAGGGAGGG + Intergenic
1191190539 X:57662067-57662089 TCTGGAAGATGAAGGAAAGGGGG - Intergenic
1192339987 X:70256393-70256415 TCTGGAACTTCAGGGAAGAAAGG + Intergenic
1192472307 X:71409854-71409876 TCTGGAAATATAGGGAAGAAAGG - Intronic
1192773375 X:74216740-74216762 CCTGGACATGGAAGGAAGTAAGG - Intergenic
1193000006 X:76553376-76553398 TCTGGAAATTGAAGAAAAGAGGG - Intergenic
1193352369 X:80478128-80478150 TCTGGAAATTGAAGGAAAGAAGG + Intergenic
1193553515 X:82928085-82928107 TCTGGAAGTTGAAGGAAGGAAGG + Intergenic
1193630063 X:83874401-83874423 TCTGCAAATTCAAAGATGGAAGG + Exonic
1194123947 X:89991287-89991309 TCTGGAGGTTGAAGGGAGGAAGG - Intergenic
1194441105 X:93935511-93935533 GCTGGAAATTGCAGTAGGGAGGG + Intergenic
1194977791 X:100410803-100410825 TCTGGTAGTGGAAGGAAGAAAGG + Intergenic
1195418773 X:104649851-104649873 TCTGGTACTTTAAGGGAGGAAGG + Intronic
1195429490 X:104772599-104772621 TGTGGAAATTGTAGCAAAGATGG - Intronic
1196045234 X:111249813-111249835 TCTCTAAAATGAAGGAAAGAAGG + Intronic
1196673180 X:118391070-118391092 TCTGGAAAAGAAAGGAAAGAAGG - Intronic
1196829160 X:119762766-119762788 TTTAGTAATTGAAGGAGGGAGGG + Intergenic
1197355908 X:125437333-125437355 TCTGCAAATTGAAGAAAGGAAGG - Intergenic
1197680005 X:129372560-129372582 TCTGCAGGTTGAAGAAAGGAGGG + Intergenic
1198409227 X:136348983-136349005 CCTGAATATTGAAGGAAGTATGG - Exonic
1198840771 X:140854973-140854995 TCTGCTATTTGAAGGAAGGAAGG - Intergenic
1199360451 X:146911827-146911849 ACTTGAAATTATAGGAAGGAGGG - Intergenic
1199456843 X:148038539-148038561 TTTGGGAAGTGAAGGCAGGAGGG + Intergenic
1199860123 X:151793911-151793933 TCTGGGCATTGAAGAAAGGCTGG + Intergenic
1199952316 X:152715935-152715957 TCTGGAAACAGAAGTGAGGAGGG - Exonic
1199957367 X:152752513-152752535 TCTGGAAACAGAAGTGAGGAGGG + Exonic
1199976906 X:152899504-152899526 GCTGGGAATTGCTGGAAGGAGGG - Intergenic
1200136345 X:153876683-153876705 TCAGGAAAATGAAGAAAGAATGG + Intronic
1200174241 X:154101310-154101332 TCTCGAAATAGATGGATGGATGG + Intergenic
1200476835 Y:3648909-3648931 TCTGGAGGTTGAAGGGAGGAAGG - Intergenic
1200738508 Y:6827765-6827787 TCAGGAAAGTGAAGGAAAGCTGG + Intergenic
1201243565 Y:11981493-11981515 TATGGACATTGAAGGTAGGATGG - Intergenic
1202021132 Y:20466288-20466310 AATGGAAATTGAAGGGAGGAGGG - Intergenic
1202027775 Y:20542507-20542529 TCTGGAGATGGAAGGGAGAAAGG + Intergenic
1202067017 Y:20950688-20950710 TCTCAAAGTTGAAGTAAGGACGG - Intergenic
1202067215 Y:20952429-20952451 TCTCAAAGTTGAAGTAAGGAGGG - Intergenic