ID: 995715932

View in Genome Browser
Species Human (GRCh38)
Location 5:115081993-115082015
Sequence TGATTCTGGAAATTGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 13, 1: 20, 2: 30, 3: 61, 4: 400}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995715932_995715941 24 Left 995715932 5:115081993-115082015 CCTTCCTTCAATTTCCAGAATCA 0: 13
1: 20
2: 30
3: 61
4: 400
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715932_995715942 25 Left 995715932 5:115081993-115082015 CCTTCCTTCAATTTCCAGAATCA 0: 13
1: 20
2: 30
3: 61
4: 400
Right 995715942 5:115082041-115082063 AGTCTGAGCTGCTGGAGCTAGGG No data
995715932_995715943 26 Left 995715932 5:115081993-115082015 CCTTCCTTCAATTTCCAGAATCA 0: 13
1: 20
2: 30
3: 61
4: 400
Right 995715943 5:115082042-115082064 GTCTGAGCTGCTGGAGCTAGGGG No data
995715932_995715940 17 Left 995715932 5:115081993-115082015 CCTTCCTTCAATTTCCAGAATCA 0: 13
1: 20
2: 30
3: 61
4: 400
Right 995715940 5:115082033-115082055 GTAATGGCAGTCTGAGCTGCTGG No data
995715932_995715938 1 Left 995715932 5:115081993-115082015 CCTTCCTTCAATTTCCAGAATCA 0: 13
1: 20
2: 30
3: 61
4: 400
Right 995715938 5:115082017-115082039 CCGGAGATCCTGTGCTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995715932 Original CRISPR TGATTCTGGAAATTGAAGGA AGG (reversed) Intergenic
901140026 1:7022661-7022683 TGCTTCAGGGATTTGAAGGAGGG + Intronic
902224396 1:14987646-14987668 TGTAGCTGGAAAGTGAAGGATGG + Intronic
903784352 1:25848143-25848165 TGTTGTTGGAAATTGATGGAAGG - Intronic
903795604 1:25927022-25927044 TATCTCTGGAAATTGAAGGTGGG - Intergenic
904198104 1:28801169-28801191 TTTTTCTGTAAACTGAAGGAGGG + Intergenic
904994738 1:34622461-34622483 GCATTCTGGAAATTGGAGGGTGG + Intergenic
906574544 1:46875944-46875966 TGATTCTGGAAATTAAAGGAAGG + Intergenic
906597431 1:47091961-47091983 TGATTCTGGAAATTAAAGGAAGG - Intronic
906913359 1:49981087-49981109 TGCTTCTGGAAATTTTAAGAAGG + Intronic
907050735 1:51328604-51328626 TAATTCTGGAGAGGGAAGGAGGG + Intronic
907620190 1:55969797-55969819 TGATTCTGGAAAATATAGTAAGG + Intergenic
907651548 1:56299750-56299772 TGTTATTGGAAATTGAAGAAGGG - Intergenic
908024654 1:59938142-59938164 TGTCTCTGGACATTGAATGAAGG + Intergenic
908850325 1:68369355-68369377 GGATTTTGGAAATTGATGAAAGG + Intergenic
909810786 1:79930032-79930054 TAAGTCTGGAAATTGATTGACGG - Intergenic
911735327 1:101330748-101330770 TGATGCTCGAAAGTGAAGAAGGG + Intergenic
912082946 1:105960029-105960051 TGTTTCAGAAAATTGAAGAAGGG - Intergenic
912282326 1:108328868-108328890 TGTTTCTGGAAATGGCAGGCTGG + Intergenic
912332385 1:108831523-108831545 TGTTTCTGTTAATTGAAGGGAGG + Intronic
912609702 1:111030389-111030411 TTATTCTAGAAATTAAAGGAAGG + Intergenic
912688161 1:111783332-111783354 TGATGGTGGAAATTCAGGGAAGG - Intronic
913313835 1:117533259-117533281 GGATTCTGGAAATTGACCAAAGG - Intergenic
915282703 1:154833457-154833479 TGGGTGTGGAAATGGAAGGAAGG - Intronic
916004880 1:160650907-160650929 TAATTCTGGAAATGAGAGGAAGG - Intergenic
916115930 1:161485092-161485114 TGATTCTGGAAATTGAAGGAAGG - Intergenic
917179157 1:172275450-172275472 TGATTCAGGTATTTGAAAGAAGG - Intronic
918705613 1:187658015-187658037 TGATAGTTGAAATTGATGGATGG + Intergenic
918814880 1:189169726-189169748 TAAGTCTGGAAATTGATTGAGGG - Intergenic
921286958 1:213617396-213617418 TGGTTGTGGAGATGGAAGGAGGG + Intergenic
921315239 1:213884268-213884290 TGACTTTGCAGATTGAAGGAAGG - Intergenic
921426934 1:215014233-215014255 TAATCCTGGAAATGGAAGGCTGG - Intronic
922390929 1:225140260-225140282 TGACTCTGGAAGTTAAAAGAGGG - Intronic
924711355 1:246532410-246532432 TGATTCTGGAAATTGAAGGAAGG + Intergenic
924955989 1:248927356-248927378 TGATGCTGGATATAGAAGCAGGG + Intergenic
1065989092 10:30990478-30990500 TGATTCAGGAGATTGGAGGTTGG - Intronic
1066271155 10:33824882-33824904 TGTCTCTGGAAAATGAAGAAAGG + Intergenic
1066414717 10:35210627-35210649 TGCTTCTGAAAATTAAAGAAGGG - Intronic
1066619040 10:37324737-37324759 TGATTCTGGAAATAGAAGGAAGG + Intronic
1067306216 10:45066364-45066386 TTATTCAGGAATTTGAAGGAGGG + Intergenic
1068303527 10:55176104-55176126 TGATTCTAGAGGTTGAAGGGAGG + Intronic
1068306435 10:55215234-55215256 TGACTTTGAAAATTGAAGAAAGG + Intronic
1068462074 10:57341873-57341895 TAATTCTGGAAATTGAAGGAAGG - Intergenic
1068735904 10:60413018-60413040 TGTTTCTGAAACTAGAAGGAAGG - Intronic
1068736991 10:60425066-60425088 TGCTTGTGGAAATTCAAGTAAGG + Intronic
1069192531 10:65507890-65507912 TAAGTCTGGAAATTGATTGAGGG + Intergenic
1069203399 10:65652541-65652563 TCATTCTGCAAATAAAAGGAGGG - Intergenic
1069791578 10:71026118-71026140 TTATTCTGGAAGTTAATGGAAGG + Intergenic
1072178306 10:92952349-92952371 TGACTCTGAAAATTTAAGGCTGG - Exonic
1073729372 10:106271144-106271166 TGATTCTGGTAATTGAAGGGAGG + Intergenic
1073854882 10:107662694-107662716 CGAGTCTGGAAATTGATTGAGGG - Intergenic
1074477571 10:113786478-113786500 TGGTTCTAGAAAATGAAGGGAGG + Intergenic
1074563361 10:114554036-114554058 TGATTCTGGGAAATGGAGAAGGG + Intronic
1075523047 10:123155466-123155488 TGTGTCTGGAAATTAAAGGAGGG - Intronic
1075826108 10:125358264-125358286 CCATTCTGGAGTTTGAAGGATGG + Intergenic
1076945895 10:133649745-133649767 TGTTTCTGCAAGTTGAAAGAAGG - Intergenic
1077275714 11:1706665-1706687 TCATGCTGGTGATTGAAGGATGG - Intergenic
1078160113 11:8832768-8832790 GGATTCTGGCAATTCAGGGATGG + Intronic
1078585364 11:12582012-12582034 TGGGTCTGGAGATTGTAGGAGGG - Intergenic
1079074212 11:17373569-17373591 TGATTCTGGAGTTCGAAGGGAGG + Exonic
1079361446 11:19773607-19773629 AGATTATGGAAATAGGAGGAAGG + Intronic
1079525452 11:21382098-21382120 TGATTCCTCAAATTGAAGAAAGG + Intronic
1080726190 11:34901458-34901480 TGATTCTGGAAATCAAAGGAAGG + Intronic
1080862110 11:36159057-36159079 AAATTGTGGAAATTAAAGGAAGG + Intronic
1082999406 11:59278004-59278026 TAAGTCTGGAAATTGACTGAGGG - Intergenic
1083104622 11:60345991-60346013 TGATTCTGGAAATTAAAGGAAGG - Intronic
1083141522 11:60725692-60725714 TCATTATGAAAATTGAAGGCAGG + Intergenic
1084243363 11:67838051-67838073 TGAGTAGGGAAATTGAGGGAAGG - Intergenic
1084760834 11:71269689-71269711 TGCATCTGGAAATAGAAGGCTGG + Intergenic
1084829334 11:71756536-71756558 TGAGTAGGGAAATTGAGGGAAGG + Intergenic
1085220870 11:74872780-74872802 TGATTCTGAAAATTGAAGGAAGG + Intronic
1086151501 11:83615694-83615716 TGATTCTGAAGATGGAAGAAGGG + Intronic
1086238560 11:84661758-84661780 ATATTCTGGAAAGTGAATGAGGG - Intronic
1087082357 11:94183844-94183866 TGATTCTAGAAAATGAAGGCAGG - Intergenic
1087689577 11:101304250-101304272 TTAATATGGAAATTTAAGGAAGG - Intergenic
1087993701 11:104777580-104777602 TGATTCTGAAATTTGAAGCCAGG - Intergenic
1088000078 11:104868028-104868050 TGATTCCTGAAATTCATGGATGG + Intergenic
1088952988 11:114589323-114589345 TAATTCTGGAAACTGAAGGAAGG + Intronic
1089266654 11:117268231-117268253 TGGTTCTGTAAATTGGAGCAAGG + Intronic
1090372481 11:126266387-126266409 TGATACTGGGATTTGAATGAGGG - Intronic
1091010853 11:131999001-131999023 TGATTCTGGATCTGGAAAGAAGG - Intronic
1092337100 12:7642763-7642785 TGATTCTGGAAATTAAAAGAAGG + Intergenic
1092413906 12:8275153-8275175 TGAGTAGGGAAATTGAGGGAAGG - Intergenic
1092833850 12:12469772-12469794 TGATACTCAAGATTGAAGGATGG + Intergenic
1093176757 12:15921315-15921337 TGATTTTGGAAATTGACATAAGG + Intronic
1094341346 12:29415023-29415045 TGATGCTGGAAATTACAGGTGGG + Intronic
1094476862 12:30847074-30847096 TAATTCTGGAAATTAAAGGAAGG + Intergenic
1095334568 12:41010152-41010174 TGATTCTGGAAATTGAAGGAAGG - Intronic
1095559554 12:43550495-43550517 TGTTTCTGGAATTTGATAGAAGG - Intronic
1095640278 12:44478918-44478940 TGATTCTGGAAATTGAAGTAAGG + Intergenic
1096249701 12:50022139-50022161 TTATTCTAGACCTTGAAGGATGG - Intronic
1097158092 12:57027178-57027200 TGATTCTGAGAAGTCAAGGATGG + Intronic
1097526252 12:60739947-60739969 TGATTCTGGAGTCTGGAGGATGG + Intergenic
1097665236 12:62470723-62470745 TGAGCCTGGAAGTTGGAGGAGGG + Intronic
1097747240 12:63315088-63315110 TAATTCTGGAAATTGAAGGGAGG - Intergenic
1097781304 12:63708133-63708155 TGATTCTGACAATAAAAGGAAGG + Intergenic
1097857618 12:64482276-64482298 TGATTATGTAACTTGAAAGAAGG - Intronic
1098104776 12:67057516-67057538 TCATACTGGAAAAAGAAGGAAGG - Intergenic
1099389148 12:82057523-82057545 TAATTCTGGAAATCAAAGAAAGG + Intergenic
1099788567 12:87299864-87299886 TGATTCAGAAAGTTGAAGGATGG - Intergenic
1100843793 12:98639354-98639376 TGTTTATGGCAAATGAAGGATGG + Intronic
1101758456 12:107639850-107639872 TTATTCTAGAAAATGAGGGAAGG + Intronic
1101848882 12:108386543-108386565 TGATTCTTGACATTGAAGGAAGG + Intergenic
1102637267 12:114335386-114335408 AGATTCTGGAAATTCGAGGTGGG - Intergenic
1104606774 12:130195313-130195335 TGATTATGAAAATTGAAACAAGG - Intergenic
1105424826 13:20285159-20285181 TGATTCTGGGGATCGAGGGAAGG + Intergenic
1105478658 13:20752470-20752492 TTATCCTGGAGATTCAAGGAAGG - Intronic
1106559581 13:30836802-30836824 TGATTCTGGAAGTTGAAAGTAGG + Intergenic
1106620665 13:31367751-31367773 TGATTCTGGGGATTGAGGGGAGG + Intergenic
1108764214 13:53606968-53606990 TCATTCTAGAAAATGAAGAAAGG - Intergenic
1108847701 13:54696512-54696534 TGATTCTGGAAGTCAAAGGGAGG - Intergenic
1109950483 13:69496712-69496734 TGATTCTCAATATTGAAGCAAGG + Intergenic
1110303656 13:73958737-73958759 TCTTTCTGGAAATTGAAAGGTGG + Intronic
1110958753 13:81593014-81593036 TCATTTTGGAAACTGAAGGTGGG - Intergenic
1111012145 13:82326859-82326881 TGATTCTGGAAATTGAAGGAAGG + Intergenic
1111077017 13:83249676-83249698 TGATGCTGAGAGTTGAAGGAAGG + Intergenic
1111275377 13:85939292-85939314 TGATTCTGGAAGTTCAAGGGAGG + Intergenic
1113027473 13:105956883-105956905 TGATCCTGGGAAGTGAGGGAGGG + Intergenic
1113090196 13:106610031-106610053 TGATGCTGCAAATGGAAGCAGGG - Intergenic
1114621917 14:24101239-24101261 TTATTCTGGGAATTGAAGCTGGG - Intronic
1117752207 14:58935882-58935904 CCATTCTGGAATTTGAAGGATGG + Intergenic
1117784988 14:59273997-59274019 GAATTCTGGGAATTGAAGGTTGG - Intronic
1118509084 14:66450732-66450754 TGTGCCTAGAAATTGAAGGAAGG - Intergenic
1118737696 14:68713990-68714012 GGATTCTTGAGATTGAAGGACGG - Intronic
1119520741 14:75283114-75283136 TTATTCTCGAAAGGGAAGGAGGG + Intergenic
1119869018 14:77998458-77998480 ATATTCTGGAAATGCAAGGATGG - Intergenic
1120170173 14:81240492-81240514 TTATTCTAGGAATAGAAGGATGG - Intergenic
1122642337 14:103167328-103167350 TAATCCCGGAAATCGAAGGAAGG + Intergenic
1202919998 14_KI270723v1_random:22342-22364 TGTTTCTGCAAGTTGAAAGAAGG - Intergenic
1202924921 14_KI270724v1_random:15296-15318 TGTTTCTGCAAGTTGAAAGAAGG + Intergenic
1124068076 15:26364434-26364456 TGATCATGGAAATAGTAGGATGG + Intergenic
1124141081 15:27077756-27077778 TTACTCTGGAAATGAAAGGAAGG + Intronic
1124968491 15:34459704-34459726 AGTTTCTGGAAATTAGAGGAAGG - Intergenic
1126519658 15:49577812-49577834 TGATATTGGAAATTCAAAGATGG + Intronic
1126790619 15:52218108-52218130 TGACTCTAAAAATTGTAGGAAGG + Intronic
1129498300 15:76008901-76008923 TGATTTTAGCAATTTAAGGAAGG - Intronic
1129510444 15:76117815-76117837 TGATTGTGGTCCTTGAAGGAGGG + Intronic
1130208759 15:81903232-81903254 TTATTCTAGAAATGAAAGGATGG + Intergenic
1131288924 15:91087890-91087912 TGATTCTAGCAACTGAATGATGG + Intergenic
1131407997 15:92182344-92182366 TTGTTCTGGATATTGAAGGATGG - Intergenic
1132190736 15:99855336-99855358 AGTTTCTGGAAATTAAAGGAAGG + Intergenic
1133355082 16:5130322-5130344 TGAGTCGGGAAATTGAGGGAAGG - Intergenic
1134886520 16:17798064-17798086 TCATTCTAGAACTTTAAGGATGG - Intergenic
1135183856 16:20298080-20298102 TCATTCTAGGAAATGAAGGATGG + Intergenic
1135288110 16:21211458-21211480 TAATTCTGGAAGTGGAGGGAGGG - Intronic
1135602798 16:23797492-23797514 TGATTCTTGAAAGGGAAGGAGGG + Intergenic
1137653566 16:50140829-50140851 GGATCCTGGAAATTGAAATAGGG - Intergenic
1138115976 16:54361043-54361065 TGATTCTAGAAAGGGAAGGGGGG - Intergenic
1140432016 16:74912445-74912467 TGTTCCTGGTAATTGAATGAAGG + Intronic
1140736888 16:77906552-77906574 AGCATCTGGAAAATGAAGGAAGG + Intronic
1141010615 16:80394471-80394493 TTATTCTAGAAATGCAAGGATGG + Intergenic
1141079013 16:81034761-81034783 TGATTCTGGAGATGGAGGAAGGG + Intergenic
1141542464 16:84736626-84736648 AGATTCTGGAAACTAAAGAATGG - Intronic
1141559770 16:84859576-84859598 CAAATCTGGAAATTGATGGAGGG + Intronic
1143820571 17:9558335-9558357 TGATTCTGCAAATCCAAGGAGGG - Intronic
1144301434 17:13925493-13925515 TAATTCTGGAAATTGAAGGGAGG + Intergenic
1144433765 17:15220857-15220879 TGATTCTGGAAAGAGAAGAAAGG + Intergenic
1146676949 17:34780319-34780341 TGATTCAGGAGATTGCAGAAAGG - Intergenic
1146677626 17:34784452-34784474 TGATTCAGGAAACTGCAGAAAGG - Intergenic
1147337413 17:39735907-39735929 TCATCCTGGATATTGAAGGATGG - Intergenic
1147746938 17:42700521-42700543 TGATTCTGCTCACTGAAGGAAGG + Exonic
1148360703 17:47010094-47010116 TGTTTCTCAGAATTGAAGGAAGG + Intronic
1148923592 17:51062212-51062234 TGATTCTGGATGTTGATGGTAGG - Intronic
1149155993 17:53630555-53630577 TGATTATGGAAATTAAAGGAAGG + Intergenic
1149667997 17:58379542-58379564 TGAATTTGGAAATTGAAGAATGG - Intronic
1150064096 17:62094335-62094357 TGATTCAGGAACTTGAAGCAGGG + Intergenic
1150510338 17:65745630-65745652 TAATTCTGGAGAGAGAAGGAGGG + Intronic
1150785834 17:68162064-68162086 TGCTTCTCAGAATTGAAGGAAGG - Intergenic
1151050169 17:70969451-70969473 TGTTACTGGAAATGGAACGAAGG - Intergenic
1151924592 17:77185510-77185532 TGTTTCAGGAATTGGAAGGATGG + Intronic
1203165671 17_GL000205v2_random:91195-91217 TGGTTTTGGAAGTTGAAAGAAGG - Intergenic
1153153306 18:2120633-2120655 TGATTGTGAAAATTGATGTAAGG + Intergenic
1153600732 18:6778928-6778950 TGATTCTGTAAGATGAAGGGAGG - Intronic
1153676034 18:7456320-7456342 TGATCCTGGAAACTGATGCATGG - Intergenic
1153761144 18:8333869-8333891 TGGTTCTGGGACCTGAAGGAGGG - Intronic
1154342915 18:13519289-13519311 TGTTTCTGGAACTAGAAGGATGG - Intronic
1154982606 18:21516013-21516035 TGAGTCTGGAGGGTGAAGGAGGG - Intronic
1155292310 18:24354472-24354494 CGAATTTGGAAACTGAAGGAAGG + Intronic
1155999369 18:32367862-32367884 TGAGTCTGGAGCTTGAGGGATGG + Intronic
1156305436 18:35874479-35874501 TGATTCTAGAAATGGAAGGAAGG + Intergenic
1156414479 18:36873356-36873378 TGTTTCTGCAAATTGCAGGAAGG - Intronic
1157398446 18:47364736-47364758 TTATTCTGGGAATGAAAGGATGG - Intergenic
1157423493 18:47565280-47565302 AGATTCTGGAAAGTGGAAGATGG - Intergenic
1157845962 18:51004427-51004449 TGAGTCTGGAAATTGATTGAAGG - Intronic
1164187203 19:22880716-22880738 TGATTCTGAAAATTGAAAGAAGG + Intergenic
1164397600 19:27879603-27879625 TAATTCTGGAAATTGAAGGAAGG + Intergenic
1164868094 19:31621634-31621656 TGAATTTGGAAGTTGAAGAAAGG - Intergenic
1165971000 19:39629776-39629798 TAATTCTGGAAATTAAGGGTAGG - Intergenic
1166438703 19:42791667-42791689 TCATTCTGGAAATTATAGGGAGG - Intronic
1166487663 19:43227521-43227543 TGATTCTGGAAATTATAGGAAGG - Intronic
1166494497 19:43289393-43289415 TCATTCTGGAAATTATAGGGAGG - Intergenic
1168182771 19:54673593-54673615 TAATTCTGGAAATTAAAGGAAGG + Intronic
1168439119 19:56348177-56348199 TGATTCTGGAAATTAAAGGAAGG + Intronic
1168680991 19:58315817-58315839 GGATTCTGGAAAATGAAGTATGG - Intergenic
925212918 2:2066088-2066110 TTTTTTTGGAAATTGAAAGAAGG - Intronic
925644611 2:6023074-6023096 TGAGACTGGAAACTAAAGGAGGG - Intergenic
925952943 2:8932799-8932821 TGACTTTGGAATTTGAATGATGG - Intronic
926825588 2:16902397-16902419 TAAGTCTGGAAATTGATTGAGGG - Intergenic
926825804 2:16903896-16903918 TAAGTCTGGAAATTGATTGAGGG + Intergenic
926949568 2:18227039-18227061 TCATTCTGGGATTTGGAGGAGGG - Intronic
927148614 2:20183101-20183123 AGGTTCTGGAAGGTGAAGGAAGG - Intergenic
929393450 2:41496808-41496830 TGATTCTGGAAATTGAAGGAAGG + Intergenic
930097792 2:47580171-47580193 TGAGTGGGGAAATTGGAGGAGGG + Intergenic
930130979 2:47850245-47850267 TGACTTTGGAGATTGAAGGTGGG + Intronic
930134927 2:47892723-47892745 TGTATCTAGAAATTGAAGGTAGG - Intronic
930313115 2:49767116-49767138 TGCATATGGAAATAGAAGGATGG + Intergenic
930583123 2:53236368-53236390 TGTTTCTGCAAATTGAAGGTTGG + Intergenic
931177585 2:59869538-59869560 TAAATCTGAAATTTGAAGGATGG + Intergenic
932116285 2:69051495-69051517 TGACTCTAGAAATTGAGGAAAGG - Intronic
932197324 2:69795998-69796020 TGATTCTGGAAATTGAAGGAAGG - Intronic
933934172 2:87187353-87187375 TGCTTTTGGAAATTTAAGAAAGG + Intergenic
934030977 2:88046602-88046624 TATTTATGGAAGTTGAAGGATGG + Intronic
934783574 2:96988528-96988550 TGAGTCTGCAAATTAAAGGTTGG + Intronic
935210439 2:100935312-100935334 TGATTCAGGAATTTGCAGAAAGG + Intronic
935425759 2:102916964-102916986 TCATTCTGGAGTTTGGAGGATGG + Intergenic
936358970 2:111778542-111778564 TGCTTTTGGAAATTTAAGAAAGG - Intronic
936636609 2:114265994-114266016 TGACTCTGGCAAATCAAGGATGG - Intergenic
937800115 2:126073203-126073225 TAAGTCTGGAAATTGATTGAGGG - Intergenic
937805838 2:126144370-126144392 TAATTTTGGAAATTGAGTGATGG + Intergenic
938010091 2:127821911-127821933 TGATTCTGGAAATCGAAGGAAGG + Intergenic
938034567 2:128026056-128026078 TGTTTCTTGAATTTGAAGAAAGG - Intronic
938364473 2:130723990-130724012 TGATTCTGAATGTTGAAGGTGGG + Intergenic
939115910 2:138060208-138060230 TTATTCTGTAAATTTAAGGGAGG + Intergenic
939429188 2:142081064-142081086 GAAGTCAGGAAATTGAAGGAAGG - Intronic
939726961 2:145732661-145732683 TGATTCTGAAAATTGAAAACTGG - Intergenic
940233172 2:151480826-151480848 TGAGTATAGAAACTGAAGGATGG + Exonic
940572928 2:155464344-155464366 TGATTATGGAATTTGGAGGTGGG + Intergenic
940588970 2:155696352-155696374 TGTTTCTGAAATTTGTAGGAAGG - Intergenic
940606132 2:155925901-155925923 CAATTCTGGAAATTGATTGAGGG + Intergenic
940793288 2:158050748-158050770 TGATTATGGAATTTGAAACAGGG + Intronic
940989854 2:160086129-160086151 TAATTCTGGAAATTGAAGGAAGG - Intergenic
941395827 2:164971597-164971619 AGATTGAGGAAATTGATGGATGG - Intergenic
943343789 2:186713104-186713126 TGAGTCTGAGACTTGAAGGAAGG + Intronic
943383231 2:187175057-187175079 TAGTTCTGGAAATCGAAGGAAGG - Intergenic
943441345 2:187931820-187931842 TGATTCAGGAACTTGAAGGGAGG - Intergenic
945318162 2:208392782-208392804 TGATTCTGAAAATTGAAGGAAGG - Intronic
945518132 2:210788584-210788606 TGCTTCTGGAAATAGAATGAAGG - Intergenic
947268297 2:228305981-228306003 CGATTCCGGAAATTGAAGGAAGG - Intergenic
947314204 2:228837305-228837327 GAATTTTAGAAATTGAAGGATGG + Intergenic
947579564 2:231306370-231306392 TGATTCTGGATATTAAAAAAAGG - Intronic
948347673 2:237312888-237312910 GGATTCTGGAAACTGAGTGAGGG - Intergenic
1169428428 20:5513951-5513973 TGATTCTAGAAAATAAAGGATGG + Intergenic
1170006902 20:11679231-11679253 TCATAAGGGAAATTGAAGGAAGG - Intergenic
1170098948 20:12677333-12677355 TGATACTGAAACTTGTAGGAAGG - Intergenic
1171783937 20:29446237-29446259 TGTTTCTGCAAGTTGAAAGAAGG - Intergenic
1171806252 20:29683000-29683022 TACTTATGGAAATTGAAGAAGGG + Intergenic
1173460590 20:43240114-43240136 TCATCCTGGAAATTGTAGGTTGG - Intergenic
1173546750 20:43903693-43903715 TGATTCTGGGAGTGGAAGGAGGG + Intergenic
1174935417 20:54862514-54862536 TGCTTCTGGACCTTGAAGTAGGG - Intergenic
1175699761 20:61128410-61128432 TGATTCTGCATATTGAAGGTGGG + Intergenic
1175706556 20:61182636-61182658 TGACTCTGGGAATTAAAGCAAGG + Intergenic
1176406082 21:6367884-6367906 TGGTTTTGGAAGTTGAAAGAAGG + Intergenic
1180150820 21:45946518-45946540 GGATTCTGGAAACCAAAGGACGG - Intergenic
1180591359 22:16939917-16939939 CAAGTCTGGAAATTGATGGAGGG + Intergenic
1182138431 22:27929867-27929889 TTATTCTGAAAATCCAAGGATGG - Intergenic
1182963692 22:34502019-34502041 TTATTCTGTCAAGTGAAGGAAGG + Intergenic
1183125244 22:35772675-35772697 GACTTCTGGAAATTGAAGAATGG + Intronic
1183738026 22:39654600-39654622 TGACTCTGGGAAGTGAAGAATGG + Intronic
1183868071 22:40719983-40720005 AGAAGCTGGAGATTGAAGGAAGG - Intergenic
949245658 3:1923364-1923386 CAAGTCTGGAAATTGATGGAGGG - Intergenic
949941038 3:9154548-9154570 TTATACTGGGAATTGAAGGAAGG - Intronic
951345103 3:21538321-21538343 TGTATCTGGAAATGGAGGGAAGG - Intronic
951400161 3:22223146-22223168 TGCTTCTGAAAACTGAAGGAGGG - Intronic
951481314 3:23165124-23165146 TGATGCTGGTATTTGAAGGATGG + Intergenic
951987456 3:28636499-28636521 TGATGCTGGGATTTGAATGAAGG - Intergenic
952723582 3:36558417-36558439 TGATTGTGCAAAGGGAAGGAAGG - Intergenic
953542847 3:43837468-43837490 TGTTTCTGGCATTTGCAGGATGG - Intergenic
953683158 3:45055159-45055181 TGATTCTGGAAGGAAAAGGAAGG + Intergenic
954494317 3:50939545-50939567 TTATTCTGGTAATACAAGGATGG + Intronic
954498190 3:50984357-50984379 TGCATCTGGAAGTGGAAGGATGG - Intronic
955494489 3:59517525-59517547 TGCTTCTTGAAATTGAATGATGG + Intergenic
955508636 3:59657498-59657520 TGATTCTGGCACTTGAACTAAGG - Intergenic
955888855 3:63629281-63629303 TGATTTGGGAAAATAAAGGAGGG + Intergenic
956557619 3:70540372-70540394 TGATTCTGGAAGTCAAAGGGAGG - Intergenic
957058932 3:75465976-75465998 TGAGTAGGGAAATTGAGGGAAGG - Intergenic
957081585 3:75640722-75640744 TGTTTCTGCAAGTTGAAAGAAGG + Intergenic
957352544 3:79044645-79044667 TTAGTATGGAAATTGGAGGAAGG + Intronic
957624925 3:82644298-82644320 TGATTCTGGAAGTCAAAGGGAGG + Intergenic
957911106 3:86620868-86620890 TAACTCTGAAAATTAAAGGAAGG + Intergenic
958062373 3:88499621-88499643 TTACTCTAGAAATTCAAGGATGG - Intergenic
958643233 3:96836148-96836170 TGATTTTGTGATTTGAAGGAAGG - Intronic
958964674 3:100546078-100546100 TGGTTTTGAAAATGGAAGGAGGG + Intronic
958989419 3:100824980-100825002 TGATTCTGGATACTGAGGAAAGG + Intronic
959204008 3:103282402-103282424 TGAGTCTGGAAATTGATTGAGGG + Intergenic
959226987 3:103598817-103598839 TAAGTCTGGAAATTGATTGAGGG + Intergenic
959309808 3:104720347-104720369 TGATTCTGGTGACTGATGGAAGG - Intergenic
959767080 3:110044442-110044464 TAATTCTGGTAATAGAAGCAAGG - Intergenic
960440276 3:117678336-117678358 TCATTCTGGAATTTGTAGCATGG + Intergenic
960689809 3:120333972-120333994 TGCTTCTGGAAATCAAAGGAGGG - Intronic
961294512 3:125873715-125873737 TGAGTAGGGAAATTGAGGGAAGG + Intergenic
961636011 3:128333277-128333299 TGATTCTGTAAAATGCTGGAGGG + Intronic
962304320 3:134272341-134272363 TGACTCTGGAAATTACAGGTAGG - Intergenic
963402266 3:144814428-144814450 TGGTGCTGGACTTTGAAGGATGG - Intergenic
963532924 3:146494014-146494036 TGAATCTGGGGATTGGAGGATGG + Intronic
963580518 3:147121156-147121178 TCATTTTGTAAATTAAAGGAAGG - Intergenic
963664883 3:148170248-148170270 TACTACTGGAAATTGAAGGGTGG + Intergenic
963761602 3:149291088-149291110 TAATTCTGGAAATTGAAGGGAGG + Intergenic
963803253 3:149698124-149698146 TCATTCTGGAATATGGAGGATGG + Intronic
964430078 3:156596266-156596288 TGATTCTAGAAAAGCAAGGAAGG - Intergenic
964589228 3:158341719-158341741 TGATTCTGGGGCCTGAAGGATGG - Intronic
964840298 3:160986266-160986288 AGATGCTGGAGAATGAAGGAAGG + Intronic
965426798 3:168535105-168535127 TCAATCTTGAAATTGAAGAAGGG - Intergenic
966050899 3:175617257-175617279 TGATTCTGGAGGTCGAAGGAAGG - Intronic
966120203 3:176512120-176512142 TGATTCTGGAAATTGAAGGAAGG - Intergenic
966688682 3:182722872-182722894 TGATTCTGGAAATTGAAGGGAGG - Intergenic
966749299 3:183306669-183306691 TGGTTGTTGAAATTGAATGATGG + Intronic
968172589 3:196522548-196522570 TGTTTCTGGAAATTGAAGGAAGG + Intergenic
969002849 4:3996200-3996222 TGAGTAGGGAAATTGAGGGAAGG - Intergenic
969751177 4:9112318-9112340 TGAGTAGGGAAATTGAGGGAAGG + Intergenic
969811085 4:9648611-9648633 TGAGTAGGGAAATTGAGGGAAGG + Intergenic
970161393 4:13192940-13192962 TTAGTTTGGACATTGAAGGATGG - Intergenic
970812128 4:20106665-20106687 TGAGTCTGGAAATAGAAGAGTGG - Intergenic
971285383 4:25284420-25284442 TGGGTATGGACATTGAAGGAGGG + Intergenic
971631509 4:28998831-28998853 CCATTCTGGAATCTGAAGGATGG - Intergenic
971663419 4:29450300-29450322 TGATTCTGAAAAGTGGAGCAAGG - Intergenic
973121224 4:46522781-46522803 CGAGTCTGGAAATTGATTGAGGG + Intergenic
974635218 4:64555300-64555322 TGATACTGCACATTGAATGATGG + Intergenic
974647715 4:64716235-64716257 TGATTCTGAAAATTAAAGGAAGG - Intergenic
976003651 4:80401747-80401769 CGATTCTGGGAACTGGAGGATGG - Intronic
976034397 4:80797309-80797331 TAAGTCTGGAAATTGACTGAGGG + Intronic
976922093 4:90453884-90453906 TGATTCTGAAAGTTGAAGGGAGG - Intronic
977103748 4:92852860-92852882 TGAAGCTGAAAATTTAAGGAAGG - Intronic
977249393 4:94672886-94672908 TGAGTCTGAAAAATGAAGGATGG + Intergenic
978369860 4:108019267-108019289 TTGTTCTGGAAAATCAAGGAAGG + Intronic
978679241 4:111358724-111358746 AGATTCTGGAAATTGAATCAGGG - Intergenic
979136513 4:117117729-117117751 TGATTCTGGAAGTTGAAGGGAGG - Intergenic
979486790 4:121279517-121279539 TAAGTCTGGAAACTCAAGGAGGG + Intergenic
979732946 4:124046359-124046381 TGATTCTGGCATTAAAAGGATGG + Intergenic
980590435 4:134880694-134880716 AGATTCTAGAAATTAAAGCAAGG - Intergenic
980951007 4:139376859-139376881 TGAGCCTGGATCTTGAAGGATGG + Intronic
981296553 4:143139961-143139983 TTAGTCTGGAAATTTAAGGAGGG - Intergenic
981572016 4:146161800-146161822 TGAATCTGGAATTTGAACGCAGG - Intergenic
981616783 4:146650799-146650821 TGATTTAGGAAATGGAAGAATGG - Intergenic
982526986 4:156490858-156490880 TAAATCTGGAAATTGACTGAGGG - Intergenic
982664891 4:158250111-158250133 TGATTCTTTAAGTTGAAGAAAGG + Intronic
982813526 4:159856612-159856634 TGATCCTGGAATGTGAAGAATGG - Intergenic
982919412 4:161254874-161254896 TGATTCTGGAAATTAAAGGAAGG - Intergenic
983062453 4:163174811-163174833 TGATTCTGGAAATTGAAGGGAGG + Intergenic
983064406 4:163192482-163192504 TGATTCTAGGAATTGAAAGAAGG - Intergenic
983412470 4:167418106-167418128 TGATTCTGGAGACTGAAGGAGGG + Intergenic
983461024 4:168026447-168026469 TGATTCTGGAAACTGAAGCAAGG - Intergenic
984073097 4:175140753-175140775 TGATTCTGGAGGTTGAAGGGAGG + Intergenic
984456488 4:179975804-179975826 TGTTTTTGGAAACAGAAGGAAGG - Intergenic
985128595 4:186719685-186719707 GTATTCGAGAAATTGAAGGATGG + Intronic
985211744 4:187603181-187603203 TAATTCTGGAAATAAATGGATGG - Intergenic
985449308 4:190050401-190050423 TGTTTCTGCAAGTTGAAAGAAGG - Intergenic
985925608 5:3014201-3014223 TGATTTTGGAATCTGGAGGATGG - Intergenic
987538388 5:19218353-19218375 TCATTGTGGAAATTAAAGTAGGG - Intergenic
987621303 5:20340691-20340713 TGATTCTGGAGGTTGAAGGGAGG + Intronic
987759167 5:22136924-22136946 TGATTCTGGAATTGTAAGCAAGG + Intronic
988237985 5:28571710-28571732 TGGTTATTGACATTGAAGGAAGG + Intergenic
988249857 5:28742559-28742581 TCATTATGGAAAATCAAGGATGG + Intergenic
988604225 5:32666352-32666374 TAATTCTGGAAGTTGAAGGGAGG - Intergenic
989125039 5:38044919-38044941 TCATTCTTCAAATTGAAGTATGG + Intergenic
989449822 5:41573502-41573524 AGACTCTGAAAATGGAAGGAAGG + Intergenic
989456170 5:41646884-41646906 TGTTTCTGGAGATGGAATGATGG - Intergenic
989821140 5:45796847-45796869 TAATTCTGGGAGTTGAAGGGAGG + Intergenic
991166050 5:63566245-63566267 TGATTCTGGAGGTTGCAGGGAGG + Intergenic
991212348 5:64120306-64120328 TGATAGTGGAAATGGAAAGAAGG - Intergenic
991248387 5:64532496-64532518 TGTTTCTGGAAGTTGAATGTAGG + Intronic
991535954 5:67669511-67669533 TCATTCTGGGGTTTGAAGGATGG - Intergenic
991680650 5:69136145-69136167 TGGACCTGGAAATTGAAGTAAGG - Intergenic
991893880 5:71370371-71370393 TGATTCTGGAATTGTAAGCAAGG + Intergenic
992613180 5:78525044-78525066 TGGTCCTATAAATTGAAGGATGG + Intronic
993378887 5:87183044-87183066 TCCTTCTGGGAATAGAAGGAGGG + Intergenic
993672680 5:90780437-90780459 AGAATTTGGGAATTGAAGGAAGG + Intronic
994371011 5:98967740-98967762 CAAATCTGGAAATTCAAGGAAGG + Intergenic
994452263 5:99956988-99957010 TGATTCTGGTGATTGAAGGGAGG - Intergenic
994771722 5:103989931-103989953 TGTTACTGGAAAGTGAAGGAAGG + Intergenic
994774682 5:104027056-104027078 TAATTCTGGAAATCAAAGGGAGG + Intergenic
994881957 5:105509502-105509524 TGATTCTAGAAATGGAAGGAAGG + Intergenic
995397759 5:111705669-111705691 TGATTCCATAAATTCAAGGAAGG - Intronic
995417261 5:111925135-111925157 TGATTCTGGAAATTGAAGGAAGG - Intronic
995715932 5:115081993-115082015 TGATTCTGGAAATTGAAGGAAGG - Intergenic
995956440 5:117782573-117782595 TGATACAGGAGAATGAAGGAAGG + Intergenic
996534469 5:124562828-124562850 TGACTGTGGAAGTAGAAGGAAGG + Intergenic
996566987 5:124891002-124891024 TGGTTCTGGAATATGAAGCAAGG + Intergenic
997621923 5:135304673-135304695 TGATTGGGGAGATTGAGGGAGGG + Intronic
998219169 5:140262148-140262170 GGCATCTGGAAATTGAAGCAAGG - Intronic
998290548 5:140910133-140910155 TAAGTCTGGAAATTGATTGAGGG + Intronic
998681998 5:144478579-144478601 TGATTCAGAAACTTGAAGCAGGG + Exonic
999648729 5:153745027-153745049 TGAGTCTGGAGAGTGAAGGAAGG - Intronic
999890802 5:155976914-155976936 GGAGTCTAGAAAATGAAGGAGGG - Intronic
1000987586 5:167877301-167877323 TCATTCTGGAAATGGAATGATGG + Intronic
1002034630 5:176458024-176458046 TTATTCTGGAAAAAGTAGGAAGG - Intronic
1003564663 6:7213093-7213115 TCATCCTTCAAATTGAAGGAGGG + Intronic
1004015758 6:11730497-11730519 TGATTCTGGAAATGGCAAGGTGG + Intronic
1004098566 6:12584718-12584740 TGATTGGAGAAACTGAAGGATGG + Intergenic
1004225694 6:13782400-13782422 TGACACTGGAAATCAAAGGAGGG + Intergenic
1004852631 6:19715819-19715841 TGTTTGTGGGAATTGAAGGATGG + Intergenic
1006289105 6:33120898-33120920 TGATTCTGGAAATTGAAGGAAGG - Intergenic
1008079574 6:47179893-47179915 TGAGTCTGGAAATTGATTGGGGG + Intergenic
1009242710 6:61200594-61200616 TGATTTTGGAAGTTGAAGGGAGG - Intergenic
1009626496 6:66143619-66143641 TAATTCTGGAAACTGAAGGAAGG - Intergenic
1010978201 6:82340554-82340576 TGATCCTGAAAATTGGAGGTGGG - Intergenic
1012414288 6:98995914-98995936 AGTTTCAAGAAATTGAAGGATGG + Intergenic
1012999178 6:106005160-106005182 TGATTTTGGCACTTGATGGAAGG + Intergenic
1014198356 6:118583257-118583279 TGATTCTGGAAATTGAAGGAAGG + Intronic
1014882322 6:126738494-126738516 TGATTCTGTAAATTATAGCAAGG + Intergenic
1015402874 6:132806619-132806641 TGGCACTGGAAATTGAAGAAAGG - Intergenic
1015514890 6:134073830-134073852 TGATCCTGGAAAATCAGGGAGGG + Intergenic
1015859923 6:137665127-137665149 TTATTATAGAATTTGAAGGAAGG + Intergenic
1017387241 6:153900673-153900695 AGAATCTGGCACTTGAAGGAGGG + Intergenic
1018123147 6:160656777-160656799 CGAGTCTGGAAATTGATTGAGGG + Intronic
1018172510 6:161153489-161153511 TGAATCAGGAACTGGAAGGAAGG + Exonic
1020019077 7:4851533-4851555 TGTTACTGGAAACTGGAGGAAGG + Intronic
1020107593 7:5429311-5429333 TGCTTCTAGAAATTCTAGGAAGG - Intergenic
1020343183 7:7134727-7134749 TATTTCTGGAACTTCAAGGAAGG - Intergenic
1020528333 7:9294654-9294676 TCATGCTGGAAAACGAAGGAAGG + Intergenic
1021187858 7:17586099-17586121 TGTGTCTTGGAATTGAAGGAGGG - Intergenic
1022370238 7:29764469-29764491 TCATTCAGGGAAGTGAAGGAGGG + Intergenic
1022987563 7:35673315-35673337 TAATTATGCAAATTGAAGGTTGG + Intronic
1023072476 7:36450178-36450200 GTATTCTGGGAATGGAAGGAAGG - Intronic
1023187315 7:37545697-37545719 TGATAATGAAAATTGAAGCAGGG + Intergenic
1023235107 7:38077584-38077606 TTATTCTGGGAATGTAAGGATGG + Intergenic
1023436236 7:40143352-40143374 TGATTTTGGAAAATGGAGGCTGG + Intronic
1023485705 7:40684105-40684127 TGATCCTTGAAGATGAAGGAAGG - Intronic
1023595323 7:41823232-41823254 TGCTTATGGAAACTGAGGGAGGG + Intergenic
1024141492 7:46467247-46467269 TGATTCTGGAGTTTGAAGGAAGG - Intergenic
1024420561 7:49160727-49160749 TGAGTCTAGAAATTTAAGGATGG - Intergenic
1025783381 7:64621618-64621640 TGATTCTGGAAATTAAAAGAAGG + Intergenic
1025868236 7:65405955-65405977 TGATTATAGAAATTGAAGAAAGG + Intergenic
1026296991 7:69061382-69061404 TGATTCTGGGAACTCAAAGAAGG - Intergenic
1026413041 7:70146219-70146241 AGATTCTGAACATTGAACGAGGG - Intronic
1027453160 7:78356120-78356142 TGACTCTGGAAGTTGAGGGTGGG + Intronic
1027599642 7:80223502-80223524 TGATTTTCAAAAGTGAAGGAAGG - Intergenic
1028217406 7:88151460-88151482 TGTTTCTGGAAATTAGAGTAAGG + Intronic
1028565951 7:92231237-92231259 TGATTCTAGAAAGTAAAGAATGG + Intronic
1028866749 7:95722478-95722500 TTTTTCTGGAACTTGGAGGATGG - Intergenic
1031657886 7:124380519-124380541 TGCTTGTGGAAAGTGGAGGAAGG + Intergenic
1031800075 7:126232159-126232181 TTATTCTGAAAATAGAAGTATGG + Intergenic
1031832766 7:126647482-126647504 TGAATCTGAAATTTGAAGAAGGG - Intronic
1032519471 7:132533059-132533081 TTATTCTGGAAATTAAAGGAAGG - Intronic
1033018723 7:137699497-137699519 TGAATATGGAAATTGGAGAAGGG + Intronic
1033585809 7:142773552-142773574 TTGTTCTGGAAATTGTGGGATGG - Intergenic
1034145495 7:148867561-148867583 TTAATCTGGAAATAGCAGGAAGG - Intronic
1034572408 7:151967200-151967222 TGATTTAGGAAATTGAAAAATGG + Exonic
1035472199 7:159117640-159117662 TGACTCTGAAGATGGAAGGAGGG - Intronic
1036086608 8:5619363-5619385 TGTGTCTGGAATCTGAAGGAGGG - Intergenic
1036374381 8:8187725-8187747 TGAGTAGGGAAATTGAGGGAAGG + Intergenic
1036876522 8:12477910-12477932 TGAGTAGGGAAATTGAGGGAAGG - Intergenic
1037685216 8:21132932-21132954 TGGTTCTTGAAATTTAAGGATGG - Intergenic
1038398090 8:27261807-27261829 TGGCTCTGGAAAGTGAGGGATGG + Intergenic
1038768264 8:30450814-30450836 TGTTTTTGAAAATTAAAGGAAGG + Intronic
1039649619 8:39327858-39327880 TAATTCTGGAAATTAAAGAAAGG - Intergenic
1040095190 8:43435837-43435859 TGATTCTGGAAATTGAAGAAAGG + Intergenic
1040524995 8:48214129-48214151 TGATTCTTGGAATACAAGGATGG + Intergenic
1040708638 8:50161268-50161290 TGATTATGGAAATCTAAGCAAGG + Intronic
1041054565 8:53970391-53970413 TGAATGTGGAAATCGATGGAAGG - Exonic
1041691965 8:60696702-60696724 TGATACTGTATATGGAAGGAAGG + Intronic
1042600832 8:70498034-70498056 TTATTCTGGAAATGCGAGGAAGG - Intergenic
1042641338 8:70938545-70938567 TGATTCTGGACAATGACAGAGGG - Intergenic
1043257789 8:78157813-78157835 TAAGTCTGGAAATTGATTGAGGG - Intergenic
1043734955 8:83730637-83730659 TGATCCTGGAAGTTGAAGGAAGG - Intergenic
1044699370 8:94951991-94952013 TTATTCTGTGAATTAAAGGATGG - Intronic
1044829004 8:96227305-96227327 TCATCCTGAAAAATGAAGGAGGG + Intronic
1044860188 8:96515450-96515472 TGATATGGGAAATAGAAGGATGG + Intronic
1045573321 8:103392401-103392423 TGCTTCTGCAAATGGAAGCAAGG + Intergenic
1045983338 8:108218350-108218372 TGAAGCTGGACCTTGAAGGATGG - Intronic
1046032640 8:108802108-108802130 TGGTGGTGGAAATGGAAGGAAGG + Intergenic
1046056219 8:109082167-109082189 TCATTCTGGGATTTGGAGGAAGG + Intergenic
1047663381 8:127063014-127063036 TTATTCTGGAAATTTAAAGTTGG - Intergenic
1047865902 8:129023987-129024009 CCATTCTGGGATTTGAAGGACGG - Intergenic
1048747208 8:137627333-137627355 TCGTCCTGGATATTGAAGGATGG + Intergenic
1050482452 9:6101070-6101092 TAAGTCTGGAAATTGATTGAGGG - Intergenic
1051605925 9:18917785-18917807 TGCTTCTGGGAATTGAGGTATGG - Intergenic
1051855901 9:21565018-21565040 AGATTTTGGAAATTTAATGAAGG - Intergenic
1052100341 9:24438569-24438591 TTATTTTGGAAATTGAATAAAGG + Intergenic
1052877803 9:33580494-33580516 TGAATCTGGGGTTTGAAGGATGG - Intergenic
1052885501 9:33643924-33643946 AGATTCTGGATATTGTCGGATGG - Intergenic
1053498180 9:38563711-38563733 TGAATCTGGGGTTTGAAGGATGG + Intronic
1056119571 9:83473809-83473831 TGAGCCTGGAACTTGAAGGAGGG - Intronic
1056573831 9:87839601-87839623 TTATTCTGGTAATAGAAGGCTGG - Intergenic
1057677649 9:97148207-97148229 TGAATCTGGGGTTTGAAGGATGG + Intergenic
1057778809 9:98033500-98033522 TGATTCAGAAAATCCAAGGAAGG + Intergenic
1058052226 9:100418439-100418461 TGATTATGGACAATAAAGGAAGG - Intergenic
1058828625 9:108796200-108796222 GAATTCTGGAAATCGAAGGGAGG + Intergenic
1058887878 9:109336484-109336506 TGACACTGGAAATGGAAGGTAGG - Intergenic
1059235573 9:112758108-112758130 TCATTCTGAAATTTGAAGAAGGG - Intronic
1060895775 9:127216111-127216133 TGGTTCTGGAAGCTGAAGGGAGG + Intronic
1203444560 Un_GL000219v1:43149-43171 TGTTTCTGCAAGTTGAAAGAAGG - Intergenic
1186090013 X:6036699-6036721 TTATTCTGGAATTTTGAGGAAGG - Intronic
1186529736 X:10282884-10282906 AGATTTTGGAAATTAAAGGAAGG - Intergenic
1186867675 X:13736350-13736372 CCATTATGGAAATAGAAGGAAGG + Intronic
1188344469 X:29046642-29046664 TGATTCTGGAACTGGAGGTAGGG - Intronic
1188828045 X:34861054-34861076 TTATTCTGGGAATACAAGGATGG - Intergenic
1189414522 X:40802663-40802685 TAATTCTGGAAATTGAAGGGAGG - Intergenic
1189594345 X:42548328-42548350 TCATTCTGGAGTCTGAAGGATGG + Intergenic
1190539133 X:51459012-51459034 TGATTCTGGAAAATAAAGGAAGG + Intergenic
1190755017 X:53394222-53394244 TGATTATGTAAAGTGAAAGAGGG + Intronic
1190997106 X:55620532-55620554 TGCTTTTGAAAATTGAAGGCAGG + Intergenic
1191101433 X:56733541-56733563 TCATCCTGAAAAATGAAGGAGGG + Intergenic
1193212827 X:78827768-78827790 GGATGCTGTAAATTGAAGAATGG - Intergenic
1193297578 X:79851151-79851173 CAATTCTGGAAATTGATTGAGGG - Intergenic
1193446951 X:81617236-81617258 CGAGTCTGGAAATTGATTGAGGG - Intergenic
1193553514 X:82928081-82928103 TGATTCTGGAAGTTGAAGGAAGG + Intergenic
1193560642 X:83012575-83012597 TTATTCTAGAAATTGAAGGAAGG - Intergenic
1194105158 X:89759639-89759661 TGATTCTGGAAATTGAAGGAAGG - Intergenic
1194123948 X:89991291-89991313 TGATTCTGGAGGTTGAAGGGAGG - Intergenic
1194338125 X:92674474-92674496 TTATGGTGGAAGTTGAAGGATGG - Intergenic
1194533306 X:95076964-95076986 TGATTCTGGTAATTAAAGGAAGG - Intergenic
1195136264 X:101909684-101909706 TGCCTTTGGAAAGTGAAGGAAGG + Intronic
1195782584 X:108481420-108481442 CAAGTCTGGAAATTGATGGAGGG + Intronic
1195853538 X:109307862-109307884 TATTTCTGGAAATTGAAGGGAGG - Intergenic
1195930368 X:110068398-110068420 TCATTTTGGAAAATCAAGGAAGG - Intronic
1196245590 X:113395405-113395427 TGATTTTTTAAAATGAAGGATGG - Intergenic
1196263139 X:113609192-113609214 TCATTCTGGATATTGGAGGGAGG - Intergenic
1197355909 X:125437337-125437359 TGATTCTGCAAATTGAAGAAAGG - Intergenic
1197419771 X:126224353-126224375 TCATTCTGGAAATTTATAGATGG - Intergenic
1198143045 X:133825171-133825193 GAATTCTGGAAATTAATGGAAGG + Intronic
1198317626 X:135485042-135485064 TGCATCTGCAAAATGAAGGATGG + Intergenic
1198454578 X:136803804-136803826 TCATTCTGACAACTGAAGGATGG + Intergenic
1198837498 X:140820226-140820248 TGATTCTGGAAATTGAAGAAAGG - Intergenic
1199395942 X:147337881-147337903 TGTGTCTGGACATGGAAGGAGGG + Intergenic
1199779343 X:151044137-151044159 TGATTCTGAACATAGAAGGGGGG + Intergenic
1199819570 X:151431247-151431269 AGATTCTAGAAATGGAAGGAAGG + Intergenic
1200457119 Y:3407456-3407478 TGATTCTGGAAATTGAAGGAAGG - Intergenic
1200476836 Y:3648913-3648935 TGATTCTGGAGGTTGAAGGGAGG - Intergenic
1200646528 Y:5791209-5791231 TTATGGTGGAAGTTGAAGGATGG - Intergenic
1201637082 Y:16135643-16135665 TGATCCTTAAAATTGAAAGAAGG + Intergenic
1201938264 Y:19431300-19431322 TGATTCTGGAAGTTGAAGGAAGG - Intergenic
1202021134 Y:20466292-20466314 TGATAATGGAAATTGAAGGGAGG - Intergenic
1202110773 Y:21416806-21416828 TGCCTCTGGAAATGGAAGAAAGG + Intergenic
1202338783 Y:23838222-23838244 TGATTCTGGAGGTGGAAGGGAGG - Intergenic
1202531983 Y:25831850-25831872 TGATTCTGGAGGTGGAAGGGAGG + Intergenic