ID: 995715933

View in Genome Browser
Species Human (GRCh38)
Location 5:115081997-115082019
Sequence CGGGTGATTCTGGAAATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995715933_995715942 21 Left 995715933 5:115081997-115082019 CCTTCAATTTCCAGAATCACCCG No data
Right 995715942 5:115082041-115082063 AGTCTGAGCTGCTGGAGCTAGGG No data
995715933_995715943 22 Left 995715933 5:115081997-115082019 CCTTCAATTTCCAGAATCACCCG No data
Right 995715943 5:115082042-115082064 GTCTGAGCTGCTGGAGCTAGGGG No data
995715933_995715941 20 Left 995715933 5:115081997-115082019 CCTTCAATTTCCAGAATCACCCG No data
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715933_995715938 -3 Left 995715933 5:115081997-115082019 CCTTCAATTTCCAGAATCACCCG No data
Right 995715938 5:115082017-115082039 CCGGAGATCCTGTGCTGTAATGG No data
995715933_995715940 13 Left 995715933 5:115081997-115082019 CCTTCAATTTCCAGAATCACCCG No data
Right 995715940 5:115082033-115082055 GTAATGGCAGTCTGAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995715933 Original CRISPR CGGGTGATTCTGGAAATTGA AGG (reversed) Intergenic
No off target data available for this crispr