ID: 995715935

View in Genome Browser
Species Human (GRCh38)
Location 5:115082007-115082029
Sequence ACAGGATCTCCGGGTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995715935_995715944 24 Left 995715935 5:115082007-115082029 CCAGAATCACCCGGAGATCCTGT No data
Right 995715944 5:115082054-115082076 GGAGCTAGGGGTTCAAGCCCTGG No data
995715935_995715940 3 Left 995715935 5:115082007-115082029 CCAGAATCACCCGGAGATCCTGT No data
Right 995715940 5:115082033-115082055 GTAATGGCAGTCTGAGCTGCTGG No data
995715935_995715941 10 Left 995715935 5:115082007-115082029 CCAGAATCACCCGGAGATCCTGT No data
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715935_995715942 11 Left 995715935 5:115082007-115082029 CCAGAATCACCCGGAGATCCTGT No data
Right 995715942 5:115082041-115082063 AGTCTGAGCTGCTGGAGCTAGGG No data
995715935_995715943 12 Left 995715935 5:115082007-115082029 CCAGAATCACCCGGAGATCCTGT No data
Right 995715943 5:115082042-115082064 GTCTGAGCTGCTGGAGCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995715935 Original CRISPR ACAGGATCTCCGGGTGATTC TGG (reversed) Intergenic
No off target data available for this crispr