ID: 995715936

View in Genome Browser
Species Human (GRCh38)
Location 5:115082016-115082038
Sequence CATTACAGCACAGGATCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995715936_995715942 2 Left 995715936 5:115082016-115082038 CCCGGAGATCCTGTGCTGTAATG No data
Right 995715942 5:115082041-115082063 AGTCTGAGCTGCTGGAGCTAGGG No data
995715936_995715941 1 Left 995715936 5:115082016-115082038 CCCGGAGATCCTGTGCTGTAATG No data
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715936_995715943 3 Left 995715936 5:115082016-115082038 CCCGGAGATCCTGTGCTGTAATG No data
Right 995715943 5:115082042-115082064 GTCTGAGCTGCTGGAGCTAGGGG No data
995715936_995715944 15 Left 995715936 5:115082016-115082038 CCCGGAGATCCTGTGCTGTAATG No data
Right 995715944 5:115082054-115082076 GGAGCTAGGGGTTCAAGCCCTGG No data
995715936_995715940 -6 Left 995715936 5:115082016-115082038 CCCGGAGATCCTGTGCTGTAATG No data
Right 995715940 5:115082033-115082055 GTAATGGCAGTCTGAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995715936 Original CRISPR CATTACAGCACAGGATCTCC GGG (reversed) Intergenic
No off target data available for this crispr