ID: 995715939

View in Genome Browser
Species Human (GRCh38)
Location 5:115082025-115082047
Sequence TCAGACTGCCATTACAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 6, 1: 13, 2: 12, 3: 24, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995715939_995715941 -8 Left 995715939 5:115082025-115082047 CCTGTGCTGTAATGGCAGTCTGA 0: 6
1: 13
2: 12
3: 24
4: 109
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715939_995715944 6 Left 995715939 5:115082025-115082047 CCTGTGCTGTAATGGCAGTCTGA 0: 6
1: 13
2: 12
3: 24
4: 109
Right 995715944 5:115082054-115082076 GGAGCTAGGGGTTCAAGCCCTGG No data
995715939_995715942 -7 Left 995715939 5:115082025-115082047 CCTGTGCTGTAATGGCAGTCTGA 0: 6
1: 13
2: 12
3: 24
4: 109
Right 995715942 5:115082041-115082063 AGTCTGAGCTGCTGGAGCTAGGG No data
995715939_995715947 25 Left 995715939 5:115082025-115082047 CCTGTGCTGTAATGGCAGTCTGA 0: 6
1: 13
2: 12
3: 24
4: 109
Right 995715947 5:115082073-115082095 CTGGCACCTCTCAGTCCTGCTGG No data
995715939_995715943 -6 Left 995715939 5:115082025-115082047 CCTGTGCTGTAATGGCAGTCTGA 0: 6
1: 13
2: 12
3: 24
4: 109
Right 995715943 5:115082042-115082064 GTCTGAGCTGCTGGAGCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995715939 Original CRISPR TCAGACTGCCATTACAGCAC AGG (reversed) Intergenic
906574537 1:46875912-46875934 TCAAACTGCTAGTACAGCACGGG + Intergenic
906597438 1:47091993-47092015 TCAAACTGCTATTACAGCACGGG - Intronic
907712409 1:56896375-56896397 TCAGACTGGAAATACATCACTGG - Intronic
912609697 1:111030357-111030379 TCAAACTGCCATTATAACACTGG + Intergenic
915084145 1:153373621-153373643 TCAGACTGCCAGAAGAGCAGGGG + Intergenic
916399978 1:164436990-164437012 TCAGACTGAAATTACACCATTGG - Intergenic
918633975 1:186752941-186752963 TCAGACTGCTATTTCAGCTGGGG + Intergenic
918664413 1:187131739-187131761 TCATAGTACCATTACAGCATTGG - Intergenic
921845124 1:219870773-219870795 TCAGACTGGAATTATACCACTGG - Intronic
922498375 1:226078581-226078603 TCTGACTCCCATTACATCTCCGG - Intergenic
923739095 1:236639500-236639522 CCAGACTGCCATCCCAGCAGTGG + Intergenic
924441509 1:244089290-244089312 TCAGACTGCCTTTGCGACACAGG - Intergenic
924711349 1:246532378-246532400 TTAAACTACCATTACAGCACAGG + Intergenic
1065435812 10:25702976-25702998 TCAAACTGCCATTTCAGGACAGG + Intergenic
1065875158 10:29991523-29991545 TTAGACTGGAATCACAGCACTGG - Intergenic
1066332489 10:34439895-34439917 TCCTACCGCCATTAGAGCACAGG + Intronic
1066692653 10:38046063-38046085 TCAGACTGCCATGACTGGGCTGG + Intronic
1067000121 10:42603038-42603060 TCAGACTGCCATGACTGGGCTGG - Intronic
1075580902 10:123617600-123617622 TCACCCTGCCACTTCAGCACAGG - Intergenic
1080726183 11:34901426-34901448 TCAGACTGCCATTACAGCACAGG + Intronic
1085220864 11:74872748-74872770 TGAAACTGTCATTACTGCACAGG + Intronic
1087424350 11:97969408-97969430 CCAAACTGCCATTACTGCACAGG - Intergenic
1088583172 11:111334741-111334763 TCATGTTGCCCTTACAGCACGGG + Intergenic
1088952979 11:114589291-114589313 TCAAATTCCCATTACAGCACAGG + Intronic
1092337097 12:7642731-7642753 TCAAACTGCCATTACAGCACAGG + Intergenic
1092397829 12:8144014-8144036 ACAGGCTGCCATTTCAGCTCAGG - Intronic
1093595176 12:20950741-20950763 TCAAACTGCTATTACAGCTCAGG - Intergenic
1094476854 12:30847042-30847064 TCAAACTGCCATTATAGCACAGG + Intergenic
1095640275 12:44478886-44478908 TCATACTGCCATTACAGCACAGG + Intergenic
1097141095 12:56903007-56903029 TCAGACTGCCATTGCCACCCTGG + Intergenic
1097348548 12:58522124-58522146 TCAGACTGGGATTACACCATTGG - Intergenic
1097519241 12:60647082-60647104 TCAAACTGCCATCACAGCACAGG - Intergenic
1102574993 12:113850565-113850587 GAAGGCTGCCATTGCAGCACTGG + Intronic
1103767422 12:123290623-123290645 GCAGATTCCCATTGCAGCACTGG - Exonic
1107728055 13:43319832-43319854 TTTCACTTCCATTACAGCACTGG + Intronic
1112486588 13:99825769-99825791 ACAGATTGCCATTCCTGCACTGG + Intronic
1112910386 13:104475703-104475725 TTTGACTTCCATTACAGTACAGG + Intergenic
1118053398 14:62053408-62053430 TCAGACTGAAACTACATCACTGG + Intronic
1123455592 15:20421007-20421029 TCATTCTGCCATTAAGGCACTGG - Intergenic
1125268680 15:37914248-37914270 TCAGACAGTCATTAAAGCCCAGG - Intergenic
1129420254 15:75419085-75419107 TCAGACTTCCATTACGGCCATGG + Intronic
1134338709 16:13325625-13325647 TCAGACTGCAACTACACCACTGG - Intergenic
1134572992 16:15307504-15307526 TCAGACTGGAACTACACCACTGG + Intergenic
1134729392 16:16448478-16448500 TCAGACTGGAACTACACCACTGG - Intergenic
1134938042 16:18263372-18263394 TCAGACTGGAACTACACCACTGG + Intergenic
1135302154 16:21339955-21339977 TCAGACTGGAATTATACCACTGG - Intergenic
1138723284 16:59107518-59107540 TCAGACTGAAACTACATCACTGG - Intergenic
1138963698 16:62058064-62058086 TCAGAATACCATTACAAAACAGG + Intergenic
1145237844 17:21221623-21221645 TCAGACTTCCATCACAGCACAGG - Intergenic
1149278981 17:55081074-55081096 TCAGACTTCCCTCACACCACTGG + Exonic
1149536893 17:57440194-57440216 TCAGACCTCTATTAGAGCACAGG - Intronic
1150467363 17:65404611-65404633 TCAGAGGGCCGTTACAGCAGTGG + Intergenic
1153410236 18:4784072-4784094 ACAGACAGCCATGGCAGCACTGG - Intergenic
1154937786 18:21078512-21078534 TCAGACTGCCATTACAGCACAGG - Intronic
1156305427 18:35874447-35874469 CCAAACTGCCATTACTGCCCAGG + Intergenic
1158555795 18:58473721-58473743 TCAGACTGGAACTACACCACTGG - Intergenic
1160379143 18:78437102-78437124 TCAAACTGCCATGAGAGCAGTGG + Intergenic
1164187197 19:22880684-22880706 TCAAACTGCCATTACAGCACAGG + Intergenic
1164397592 19:27879571-27879593 TCAGACTGCCATTACAGCACAGG + Intergenic
1165971009 19:39629808-39629830 TCAGATTGCCCTTATAGCACAGG - Intergenic
1166427172 19:42689233-42689255 TTAAGCTGCCATTACTGCACAGG - Intronic
1166438709 19:42791699-42791721 TCAAACTGCCATTACAGCACAGG - Intronic
1166473721 19:43102488-43102510 TGAAACTGCCATTACAGCACAGG - Intronic
1166487668 19:43227553-43227575 TCAAACTGCCATTACAGCACAGG - Intronic
1166494503 19:43289425-43289447 TCAAACTGCCATTACAGCACAGG - Intergenic
1166591992 19:44007795-44007817 CCAGGCTGCCATCACAGCACTGG + Intronic
1167857053 19:52250560-52250582 TCAAACTGGAATTACAACACTGG + Intergenic
1168439114 19:56348145-56348167 TCAAACTGCCATTATAGCACAGG + Intronic
926480287 2:13384217-13384239 TCATTCTGCCATTAAGGCACTGG + Intergenic
926678123 2:15643414-15643436 TCATACTGCCTTAACAGCAGCGG - Intergenic
928481991 2:31692539-31692561 TCAAACTGCCATTATTGCACAGG - Intergenic
929321380 2:40547267-40547289 TCTTACTGCCTGTACAGCACTGG - Intronic
931013007 2:57940212-57940234 TCAGACTGGAATTACACCACAGG - Intronic
932197333 2:69796030-69796052 TCAGACTGCCATCACTGTTCAGG - Intronic
932730705 2:74220065-74220087 TCAAACAGTAATTACAGCACAGG - Intronic
935543145 2:104373272-104373294 TCAGATTGCCATTACATCCCTGG + Intergenic
936386893 2:112038853-112038875 TGAGACTGCCACTGCAGCAGTGG + Intergenic
937842959 2:126544527-126544549 TCAGATGGCCAGAACAGCACTGG + Intergenic
938010083 2:127821879-127821901 TTGAACTGCCATTACTGCACAGG + Intergenic
938730999 2:134147238-134147260 TTAGACTTCCGTTACAGCACTGG - Intronic
939260389 2:139800957-139800979 TAAGACTGCCATCACAATACAGG + Intergenic
940544067 2:155061129-155061151 TCAGACTGGAATTACACCATTGG - Intergenic
941311991 2:163944877-163944899 TCACACTTCAATTTCAGCACAGG - Intergenic
943441356 2:187931851-187931873 TCAGACTGCCATTACCCTCCAGG - Intergenic
943903804 2:193473159-193473181 TCAGACTGCCATTACCATCCAGG + Intergenic
945340153 2:208642972-208642994 TCAGACAGTGATGACAGCACAGG + Intronic
946136183 2:217649082-217649104 TCAGAGTCCCAAGACAGCACAGG - Intronic
947049567 2:226026939-226026961 TCACACTGCTATTATAGCAAAGG - Intergenic
947268304 2:228306013-228306035 TCAGACTGCCATTACAGCACAGG - Intergenic
1170094315 20:12629268-12629290 TCAGGCTCCCATTACAGCAGTGG + Intergenic
1175219390 20:57408312-57408334 TCAGACTGCGCTCACAGCTCGGG - Exonic
1177315235 21:19451803-19451825 TCAGGCTGCCATCAGAGTACTGG + Intergenic
1177442695 21:21147941-21147963 TCAGACTGGAATCACAGCACTGG - Intronic
1179442243 21:41403438-41403460 CCAGCCTGCCATTACATCCCTGG - Intronic
1180845378 22:18978382-18978404 TCAGTCTGGCTTTAGAGCACAGG - Intergenic
1184108094 22:42380126-42380148 CCAGACTCCAATTACAGCAAAGG - Intergenic
952684389 3:36132075-36132097 TCAGACTGCCATTACCATCCAGG + Intergenic
955261125 3:57391408-57391430 TCAGACTGGAACTACATCACTGG + Intronic
957911101 3:86620836-86620858 TCAAACGGTCATTACAGCACAGG + Intergenic
959432310 3:106270227-106270249 TCAGACTGGAATTACACCATTGG - Intergenic
960564130 3:119116355-119116377 TCAGACTGGAATTATACCACTGG + Intronic
962334031 3:134509645-134509667 GGAGACTGCCATTAAAACACAGG + Intronic
962557556 3:136571144-136571166 TCAGACTGCCTTTATATTACTGG - Intronic
964525567 3:157612698-157612720 TCCCACTTCCAGTACAGCACAGG + Intronic
964605776 3:158558617-158558639 TCTGACAGTCCTTACAGCACTGG + Intergenic
965819722 3:172672998-172673020 TCAAACTGCCATCATAGCATAGG + Intronic
966120211 3:176512152-176512174 TCAGACTGCCATTACCACACAGG - Intergenic
968172583 3:196522516-196522538 TCAAACTGCCATTACAGCACAGG + Intergenic
968462955 4:734913-734935 GCAGACTGTCATCAAAGCACAGG - Exonic
971363058 4:25954412-25954434 TCAGACCGGAATTACAGCATGGG - Intergenic
973554736 4:52071783-52071805 TCAGCCTGCCATTATTGCATTGG - Intronic
974647720 4:64716267-64716289 TCAAACTGCCATTACAGCACAGG - Intergenic
976101807 4:81572267-81572289 TCACACTGACATTTCAGCAATGG + Intronic
978491461 4:109315691-109315713 TCAGACTGCCATTACCATCCAGG + Intergenic
980941702 4:139280636-139280658 TCAGCCTTCCATTAGCGCACTGG + Intronic
983412462 4:167418074-167418096 TCAGGCTGCCATTACAGCACAGG + Intergenic
990333625 5:54751113-54751135 TCGGACTTCCATGACAGCTCAGG + Intergenic
991550914 5:67835010-67835032 TCAGACACCAATCACAGCACTGG + Intergenic
993840612 5:92874289-92874311 TCATAGTGCAATTACATCACTGG + Intergenic
995715939 5:115082025-115082047 TCAGACTGCCATTACAGCACAGG - Intergenic
998765762 5:145485620-145485642 TAAGACTGCCATTTTAGCACAGG - Intronic
999809987 5:155118379-155118401 TCAGACTGGGACTACACCACTGG + Intergenic
1006289112 6:33120931-33120953 TCAAACTGCCATTACAGCACGGG - Intergenic
1008678900 6:53851340-53851362 TCAGACTGGAATTACACCACTGG - Intronic
1009683096 6:66923974-66923996 TCACACTGCTATTACAGCACAGG - Intergenic
1009934225 6:70214469-70214491 TCATACTGCCATAGAAGCACCGG + Intergenic
1010209041 6:73348606-73348628 TCAGCCTCCCAGCACAGCACCGG + Intergenic
1010574026 6:77510404-77510426 TCAAACTGCCATTACAGCACAGG - Intergenic
1011568385 6:88705320-88705342 TTAGACTGACATTATACCACTGG - Intronic
1012229727 6:96746699-96746721 TCAGACTGGAACTACACCACTGG + Intergenic
1013823452 6:114183058-114183080 TCAAACTGGGATTACATCACTGG + Intronic
1014198350 6:118583225-118583247 TCAGACTGCCATTACAGCACAGG + Intronic
1017626023 6:156349686-156349708 TCAGACTCCCATAACAGACCTGG + Intergenic
1019324970 7:433561-433583 TCAGCCTGCCTTGCCAGCACAGG + Intergenic
1020357786 7:7296357-7296379 TCATACCGCCATCACACCACAGG - Intergenic
1022847063 7:34220970-34220992 TCACAGTGCAATTACAGCACTGG - Intergenic
1025783374 7:64621586-64621608 TCAAACTGCCATTATAGCCTAGG + Intergenic
1028251581 7:88544716-88544738 TCAAGCTGCCATTACAGCACTGG - Intergenic
1031126742 7:117782176-117782198 ACAACCTGCCATTTCAGCACAGG + Intronic
1035962333 8:4150918-4150940 GCAGACTGTAATTAAAGCACAGG - Intronic
1036180700 8:6582113-6582135 TCAGACGTCCTTTACAACACAGG - Intronic
1038724993 8:30073847-30073869 TTAGACTGCCATTACTGTAGTGG + Intronic
1039649625 8:39327890-39327912 TCAAACTGCCATTATAGCACAGG - Intergenic
1042522759 8:69731486-69731508 TTTAACTGCCATTAGAGCACTGG + Intronic
1043268853 8:78303095-78303117 TCAGCCTGCCATTATAATACTGG + Intergenic
1044739616 8:95312886-95312908 TCAGACCTCCCTTACATCACTGG - Intergenic
1046107149 8:109679772-109679794 TAAAACTGCCTTTAGAGCACTGG + Intronic
1050829959 9:9998326-9998348 TCAAACTGCCATTATAGCACAGG + Intronic
1054966496 9:71033897-71033919 TCAGGCTGCCATCCCATCACAGG + Intronic
1188875332 X:35423219-35423241 TCAGAATGCTTTTTCAGCACTGG + Intergenic
1189313231 X:40034714-40034736 CCAGAGTGCCATTGCAGCAATGG + Intergenic
1191204451 X:57819723-57819745 TCAAACTGCCATTACAGCACAGG - Intergenic
1192053677 X:67749915-67749937 TCAGATTGCTATTACAGCAAAGG - Intergenic
1193348220 X:80429034-80429056 TCAGACTGCCATTATGACTCAGG - Intronic
1193352362 X:80478092-80478114 TCAGACAGTTATTACAGCATAGG + Intergenic
1193560649 X:83012607-83012629 TCAAACTGCCATTACTGCTCAGG - Intergenic
1193574601 X:83182994-83183016 TCAGACTGCCATTGCCGTTCAGG - Intergenic
1194105169 X:89759670-89759692 TCAGACTGCCGTTACAGCCCAGG - Intergenic
1194533315 X:95076996-95077018 TCAAACTGCCCTTATAGCACAGG - Intergenic
1197690469 X:129495131-129495153 ACAGAATGCCATTCCATCACAGG - Intronic
1198445564 X:136710467-136710489 TCAGGATGGCATTACAGCAGAGG - Intronic
1198837504 X:140820258-140820280 TCAAACTGCCATCATAGCACAGG - Intergenic
1198841123 X:140859148-140859170 TCATATTGCTATCACAGCACTGG - Intergenic
1200457128 Y:3407487-3407509 TCAGACTGCCGTTACAGCACAGG - Intergenic