ID: 995715941

View in Genome Browser
Species Human (GRCh38)
Location 5:115082040-115082062
Sequence CAGTCTGAGCTGCTGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995715932_995715941 24 Left 995715932 5:115081993-115082015 CCTTCCTTCAATTTCCAGAATCA 0: 13
1: 20
2: 30
3: 61
4: 400
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715937_995715941 0 Left 995715937 5:115082017-115082039 CCGGAGATCCTGTGCTGTAATGG No data
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715935_995715941 10 Left 995715935 5:115082007-115082029 CCAGAATCACCCGGAGATCCTGT No data
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715931_995715941 28 Left 995715931 5:115081989-115082011 CCTTCCTTCCTTCAATTTCCAGA 0: 9
1: 16
2: 14
3: 60
4: 612
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715939_995715941 -8 Left 995715939 5:115082025-115082047 CCTGTGCTGTAATGGCAGTCTGA 0: 6
1: 13
2: 12
3: 24
4: 109
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715933_995715941 20 Left 995715933 5:115081997-115082019 CCTTCAATTTCCAGAATCACCCG No data
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data
995715936_995715941 1 Left 995715936 5:115082016-115082038 CCCGGAGATCCTGTGCTGTAATG No data
Right 995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995715941 Original CRISPR CAGTCTGAGCTGCTGGAGCT AGG Intergenic
No off target data available for this crispr