ID: 995717278

View in Genome Browser
Species Human (GRCh38)
Location 5:115092614-115092636
Sequence CAGCTATCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995717278_995717283 20 Left 995717278 5:115092614-115092636 CCATCCACCACTGCTGATAGCTG No data
Right 995717283 5:115092657-115092679 GACTTCCACCCCTCCGGATCTGG 0: 31
1: 87
2: 117
3: 65
4: 76
995717278_995717284 24 Left 995717278 5:115092614-115092636 CCATCCACCACTGCTGATAGCTG No data
Right 995717284 5:115092661-115092683 TCCACCCCTCCGGATCTGGCAGG 0: 15
1: 49
2: 110
3: 147
4: 224
995717278_995717282 14 Left 995717278 5:115092614-115092636 CCATCCACCACTGCTGATAGCTG No data
Right 995717282 5:115092651-115092673 GCTGCTGACTTCCACCCCTCCGG No data
995717278_995717286 25 Left 995717278 5:115092614-115092636 CCATCCACCACTGCTGATAGCTG No data
Right 995717286 5:115092662-115092684 CCACCCCTCCGGATCTGGCAGGG 0: 13
1: 54
2: 111
3: 168
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995717278 Original CRISPR CAGCTATCAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr