ID: 995725551

View in Genome Browser
Species Human (GRCh38)
Location 5:115178278-115178300
Sequence ATAAATGGACTACTCTTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995725551_995725553 -7 Left 995725551 5:115178278-115178300 CCTATCAAGAGTAGTCCATTTAT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 995725553 5:115178294-115178316 CATTTATTTTGTTCAACCAAAGG 0: 1
1: 0
2: 1
3: 27
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995725551 Original CRISPR ATAAATGGACTACTCTTGAT AGG (reversed) Intronic
902568201 1:17329380-17329402 ACTAATAGACTACTGTTGATGGG + Intronic
906880404 1:49583155-49583177 ATGAAGGAACAACTCTTGATGGG + Intronic
909997498 1:82298576-82298598 CTCAATGGAAAACTCTTGATTGG + Intergenic
910096362 1:83526522-83526544 ATCCATGGACTACACTTGGTAGG - Intergenic
910148320 1:84109136-84109158 TTAAATGTTCTACTATTGATGGG + Intronic
910638221 1:89432361-89432383 TTAAATGGAATTCTCTTGACTGG + Intergenic
911222968 1:95270228-95270250 ATAAAACCACTACTCTTGATTGG - Intergenic
911841219 1:102684907-102684929 AAAAATGGACCACTCTTGTGGGG - Intergenic
911977188 1:104513632-104513654 ATAAATTGACTATTTTTGACTGG - Intergenic
915820566 1:159019094-159019116 ATAAATTGACTACTCATGGCTGG + Intronic
917063150 1:171062915-171062937 ATAAATGTACTACTCTGGTGGGG - Intronic
919429964 1:197480527-197480549 ACAAACAGACTCCTCTTGATGGG - Intergenic
919589593 1:199484128-199484150 ATAATAGGATTACTCTTCATAGG - Intergenic
923085503 1:230700514-230700536 AGAAATGGACCACTCTGGGTGGG + Intergenic
923510886 1:234651768-234651790 ATAAAGGGCCTTCTCTTTATAGG - Intergenic
924138944 1:241002018-241002040 ACAAATGTACTACTCTGGTTGGG + Intronic
924362035 1:243252090-243252112 AGAAATGGGATACTTTTGATGGG - Intronic
1065153529 10:22846921-22846943 ATAAATCAATTACTCTTGATAGG - Intergenic
1071942368 10:90604251-90604273 ATAAATGGAGTAGTGGTGATGGG - Intergenic
1072082934 10:92051152-92051174 ATAAATGGAATGCTCTGAATGGG - Exonic
1073920960 10:108458169-108458191 ATAAATAGTCTACTGTTGAATGG + Intergenic
1074054473 10:109909903-109909925 ACAAATGTACTACTCTGGTTGGG - Intronic
1075136715 10:119793260-119793282 ATAAATGCAAAACTCTTGACAGG - Intronic
1080395218 11:31883642-31883664 ACAAATGGACTACTCTGGTGGGG + Intronic
1081422374 11:42884629-42884651 ATATATGGACTACTGTTCAATGG + Intergenic
1085376963 11:76072576-76072598 ATAAAAGGAAGACTTTTGATAGG + Intronic
1087252392 11:95917580-95917602 ATTAATAGACTACTGTTGACTGG + Intronic
1087566413 11:99864681-99864703 AAAAATCGACTTCTTTTGATAGG + Intronic
1088090687 11:106035823-106035845 AGAAGTAGACTCCTCTTGATTGG - Intergenic
1088323112 11:108573361-108573383 ATGAATGGTCTACCCTTGGTTGG + Intronic
1093943512 12:25081809-25081831 ATAAAAGGACTACTGTTTCTTGG + Intronic
1095841683 12:46700763-46700785 ATAAATGGTGACCTCTTGATTGG + Intergenic
1097952153 12:65443376-65443398 AGAAATGCACTATTTTTGATAGG + Intronic
1107041467 13:35952781-35952803 ATAAATGGACTGTTTTTCATTGG - Intronic
1107233698 13:38142838-38142860 ATTAATAGACTACTGTTGACTGG - Intergenic
1109389494 13:61673975-61673997 ATAAATGAACTACTGCTCATGGG + Intergenic
1111025156 13:82510897-82510919 AGAAATGGACTTATCTTGTTTGG - Intergenic
1111545646 13:89731977-89731999 ACAAATTGTCTACTGTTGATTGG + Intergenic
1112662362 13:101525258-101525280 ATTAATGGACTTTTCTTGTTTGG + Intronic
1113187339 13:107703675-107703697 ATAAATGGATTAGAATTGATAGG - Intronic
1116574966 14:46562035-46562057 ATAAATGTACCACTCTGGTTGGG + Intergenic
1117769258 14:59116336-59116358 ATAAATGTACCACTCTGGAAGGG + Intergenic
1118615593 14:67572541-67572563 ATATATGGAAAACTCTTCATGGG - Intronic
1119167000 14:72502795-72502817 GTAACTGGACCACTCTTCATTGG + Intronic
1122533849 14:102448254-102448276 ATAAATGCCCTACTCCTGGTCGG - Intronic
1126616543 15:50587627-50587649 ATAAATGGACATTTCTTAATGGG - Intronic
1131317033 15:91348268-91348290 ATAAATGGACTAGTCTTTGGCGG + Intergenic
1137881476 16:52053379-52053401 ATAAAAGGACTAGACTTGGTGGG - Intronic
1139222267 16:65195636-65195658 ATCACTTGACTACTCTTAATTGG - Intergenic
1141185967 16:81787664-81787686 ATAAAGGTTCTACTTTTGATTGG - Intronic
1144365541 17:14541195-14541217 ATAAATAGCCTACTATCGATAGG - Intergenic
1146476876 17:33169965-33169987 ATAAATGGACTCATCTTGGGGGG - Intronic
1147305160 17:39558428-39558450 ATAAATGGAGTTCTCTTTACTGG - Intronic
1153120218 18:1715206-1715228 ACAAATGGGCTACTATTGATGGG - Intergenic
1158686933 18:59623059-59623081 ATAAATGCACCACTCTGGAAAGG + Intronic
1159221448 18:65469249-65469271 ATAGATCCTCTACTCTTGATAGG + Intergenic
1165848298 19:38833358-38833380 ATAAACAGTCTACTGTTGATGGG - Intronic
1166909611 19:46143352-46143374 ACAAATAGCCTACTGTTGATGGG - Intronic
1168260682 19:55192488-55192510 ACTAATAGCCTACTCTTGATTGG - Intronic
926548733 2:14274834-14274856 AAAAATAGCCTACTGTTGATTGG - Intergenic
930810878 2:55539066-55539088 ACAAATGTACTACTTTTGAGGGG - Intronic
930850436 2:55954972-55954994 ATAATTTGGCTGCTCTTGATGGG + Intergenic
936860725 2:117015920-117015942 ATATATTTACTACTCTTGAGAGG - Intergenic
936964114 2:118110237-118110259 ACTAATAGCCTACTCTTGATGGG + Intronic
940694486 2:156961187-156961209 ATAAATGTACAACTTTTGAAAGG + Intergenic
943926041 2:193781909-193781931 ATAAATTGACAACTCTTTTTAGG + Intergenic
944153922 2:196591826-196591848 ATAAAAGGCCTAATCTGGATGGG - Intronic
945784856 2:214220741-214220763 ATCAATGGATTAATCTTGAAGGG + Intronic
1168846533 20:948940-948962 ATAAAGAGACTACTCGAGATGGG + Intergenic
1169117878 20:3077779-3077801 AGAAATAGACTTCTCGTGATGGG - Intergenic
1169930532 20:10827995-10828017 GGAAATGGACTCCTCTTGAGAGG - Intergenic
1170211999 20:13855128-13855150 AAAAATGGACTAGTCTTCAATGG + Intronic
1170316265 20:15044202-15044224 CTAATAGGATTACTCTTGATGGG - Intronic
1171925451 20:31185282-31185304 ATGAATGGAATACACCTGATTGG + Intergenic
1173396051 20:42680938-42680960 TTACATGGTCTACTCTTGAGGGG - Intronic
1177515820 21:22149343-22149365 ATAAATGGACAACTATTTAAAGG - Intergenic
953259761 3:41326209-41326231 ATAATGGTACTACTCGTGATTGG - Intronic
955480293 3:59383118-59383140 ACAAATGGCCCACTCTTGAGTGG - Intergenic
958623710 3:96597528-96597550 ATAAATGGAATATTCTGGAATGG + Intergenic
959146933 3:102557979-102558001 ATAAATAGGCTACTGTTGACTGG - Intergenic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
961026036 3:123558448-123558470 ACAAATGTACTACTCTGGTTGGG + Intronic
963646608 3:147923027-147923049 AAGGATGGACTCCTCTTGATGGG - Intergenic
966051882 3:175627464-175627486 ATATACGGATTGCTCTTGATTGG - Intronic
970526814 4:16940998-16941020 AAAAAAGGACTAATCGTGATTGG + Intergenic
971043206 4:22777962-22777984 AGAAATGAACAACTCTGGATGGG - Intergenic
971216629 4:24668071-24668093 ATATATGCACTTCCCTTGATAGG + Intergenic
971530534 4:27683034-27683056 ATAAATGGACTAAGTTTGACAGG + Intergenic
973208865 4:47592104-47592126 ATAAAAGGTCTTCTCTTGATTGG - Exonic
973739746 4:53908260-53908282 AGAAATGCACTTCTCTTGCTAGG + Intronic
974463063 4:62214946-62214968 ATAAATGGAATATTCATGAAAGG + Intergenic
975347965 4:73315488-73315510 AAAAATGAATTCCTCTTGATAGG + Intergenic
975695597 4:77009701-77009723 ATATTTGGACTACTATTGAGAGG + Intronic
977856204 4:101897474-101897496 ATAGATGGAGAACTCTGGATGGG + Intronic
980319149 4:131245414-131245436 ACAAATACACTACTCTTGTTGGG - Intergenic
980918807 4:139061502-139061524 ATAAATGGATTTATGTTGATAGG - Intronic
981142834 4:141290123-141290145 ATAAATGGACTACTCTTTGCAGG - Intergenic
983391439 4:167135918-167135940 AAAAATGGTCTATTCTTCATAGG - Intronic
983835181 4:172376327-172376349 ATAGATGGGCTAGTCTTGCTTGG + Intronic
984445185 4:179828003-179828025 AAAAAAGGATTACTCTGGATAGG - Intergenic
985050457 4:185986068-185986090 TGAAATGGAGTACTCTTTATGGG - Intergenic
989269651 5:39517175-39517197 ATTGATGGACTACTATTGGTTGG - Intergenic
990110639 5:52318840-52318862 AAAAATGGAATTCTCTAGATAGG - Intergenic
992358295 5:76008721-76008743 TTAAATGGACCATTCTGGATTGG - Intergenic
995725551 5:115178278-115178300 ATAAATGGACTACTCTTGATAGG - Intronic
996063466 5:119056574-119056596 ATAAATGCACCACTCTGGTTGGG + Intronic
996632176 5:125646738-125646760 ATAAATGGAATGCTCATGAATGG + Intergenic
996926253 5:128830000-128830022 AAACATGGACTGCTTTTGATAGG + Intronic
997792627 5:136774758-136774780 ATAAATGGCCTTCCTTTGATTGG - Intergenic
1008139955 6:47820868-47820890 ATTAATGGCCTACTGTTGACCGG + Intronic
1008478980 6:51964642-51964664 ATAAATGGTCAACTCTTATTTGG + Intronic
1009687133 6:66976324-66976346 ATAAATGGCCCACTCATGGTGGG + Intergenic
1015268867 6:131318259-131318281 GTAAATTGACTAATCTTGTTGGG + Intergenic
1015757188 6:136619543-136619565 ACAAATGGACTACTCTGGTGGGG - Intronic
1022876070 7:34531765-34531787 ATAAATGTACCACTCTGGTTTGG + Intergenic
1023524580 7:41086327-41086349 ACAAATGTACCACTCTGGATTGG - Intergenic
1030916564 7:115321533-115321555 ATAAATAGGCTAGTTTTGATTGG + Intergenic
1031061182 7:117053371-117053393 AAACACGGACTACTCTTGTTAGG + Intronic
1031165914 7:118226419-118226441 ATAAATAGCCTACTATTGATTGG + Intronic
1036535401 8:9645290-9645312 ATGAATGGGCTTCTCTTCATAGG - Intronic
1037204427 8:16297377-16297399 TTCAATGGACTTCTCTTTATTGG - Intronic
1038096816 8:24322193-24322215 ATTATTGGAATAATCTTGATTGG + Intronic
1038534084 8:28341565-28341587 ATAAATGGATTCCTGTTAATGGG - Intronic
1040979635 8:53233290-53233312 ATAAATGGACCACTCTGTAGGGG + Intronic
1042139055 8:65661255-65661277 ATAAATGCACCACTCTTGTGTGG + Intronic
1043295837 8:78662727-78662749 AAAAATGGACTAGTCTAGAGAGG + Intergenic
1045918808 8:107505788-107505810 ATTAAAGGACTAGTCTTTATGGG - Intergenic
1048047693 8:130788928-130788950 ATAAATGAAATAATCATGATAGG - Intronic
1048246093 8:132802016-132802038 TTAAATGCTCTACTCTTAATAGG + Intronic
1048636607 8:136302959-136302981 ATATGTGGACTACTGTTGATCGG - Intergenic
1055224217 9:73974654-73974676 ATAAATTGATTGATCTTGATTGG + Intergenic
1055519489 9:77065828-77065850 ACAAATAGCCTACTGTTGATTGG - Intergenic
1058042962 9:100324421-100324443 AAAAAGGGACTACTTTAGATGGG + Intronic
1059468220 9:114483071-114483093 ATGAATGGTCTACGCTTGAGTGG - Intronic
1060504056 9:124184865-124184887 ACAAATGGACCACTCTTGTGGGG - Intergenic
1194392674 X:93340270-93340292 ATTAATAGCCTACTCTTGACTGG - Intergenic
1196096034 X:111800824-111800846 ACTAATAGCCTACTCTTGATGGG - Intronic
1196313702 X:114197987-114198009 ATAAATGTACCACTCTGGTTGGG + Intergenic
1197379920 X:125727262-125727284 GTAGATGGACTTCTCTTGAGTGG - Intergenic