ID: 995727216

View in Genome Browser
Species Human (GRCh38)
Location 5:115193883-115193905
Sequence CTGCTGGGGCAGGTGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995727213_995727216 -10 Left 995727213 5:115193870-115193892 CCTCTGCCTAGATCTGCTGGGGC No data
Right 995727216 5:115193883-115193905 CTGCTGGGGCAGGTGAAGCTTGG No data
995727211_995727216 -9 Left 995727211 5:115193869-115193891 CCCTCTGCCTAGATCTGCTGGGG No data
Right 995727216 5:115193883-115193905 CTGCTGGGGCAGGTGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995727216 Original CRISPR CTGCTGGGGCAGGTGAAGCT TGG Intergenic
No off target data available for this crispr