ID: 995734288

View in Genome Browser
Species Human (GRCh38)
Location 5:115282346-115282368
Sequence CTGAGCAAAGCAAAGATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 357}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995734288 Original CRISPR CTGAGCAAAGCAAAGATAGA TGG (reversed) Intronic
900994928 1:6115930-6115952 CTGTGCAAAGAAAATATACATGG + Intronic
902737775 1:18412637-18412659 CTGAGCCATGCATAGAGAGAGGG + Intergenic
903636008 1:24816585-24816607 CTGAGCAAAGCAAAGTGACCTGG - Intronic
904331893 1:29764482-29764504 CTCAGCAAAGTAAGAATAGAAGG + Intergenic
904441915 1:30537512-30537534 CTGGTCATAGCAAAGACAGAGGG + Intergenic
905664942 1:39757705-39757727 CTGAGCAAAGAAAAGGGAAATGG + Exonic
909279627 1:73732619-73732641 CTCAGCAAAATAAAAATAGAGGG + Intergenic
909471247 1:76030824-76030846 CTTAGCAAAGAGAAGATATAGGG + Intergenic
910663258 1:89696446-89696468 CTGAGTAAAGAACAGACAGAGGG + Intronic
911155269 1:94630122-94630144 AAGAGAAAAGCAAAGATAAAAGG - Intergenic
911727644 1:101258525-101258547 CTGTGGAAAGCAGAGAGAGAGGG - Intergenic
912694132 1:111828171-111828193 CTGAGCCCAGCGAACATAGATGG - Intronic
913404810 1:118477840-118477862 CAGAGGAAAGAGAAGATAGATGG - Intergenic
913446292 1:118954218-118954240 CTGGGCAAAGCAAGGATCAAAGG + Intronic
913541604 1:119826347-119826369 CTGAGCAAACCAAAAATCGAGGG - Intergenic
913695399 1:121319950-121319972 CTGTGCAAACAAATGATAGATGG + Intronic
914142164 1:144960110-144960132 CTGTGCAAACAAATGATAGATGG - Intronic
914423273 1:147549817-147549839 CTGAGGAAAGCAAACACAGAGGG - Intronic
915179445 1:154045275-154045297 GTAAGAAAAGCAAATATAGAGGG - Intronic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
915744883 1:158148233-158148255 CACAGCAAAGCAAGGAAAGAAGG - Intergenic
916513676 1:165496022-165496044 CTGAGCTAAGGAAAGATACGTGG + Intergenic
917295646 1:173516269-173516291 CTTAGCAAATGAAACATAGAAGG + Intronic
917476336 1:175372453-175372475 CTAAGATAAGGAAAGATAGAGGG + Intronic
917733940 1:177903272-177903294 CTGAGCACAGCAAATATGGTGGG - Intergenic
918402685 1:184179454-184179476 CTGACCAAACCAAAGAAATATGG - Intergenic
919509646 1:198446193-198446215 CTGAGCAAAAAAAAGGCAGATGG - Intergenic
919845372 1:201639124-201639146 CAGAGCAAAGCAAAGGTGCAGGG + Intronic
920482730 1:206338329-206338351 CTGTGCAAACAAATGATAGATGG + Intronic
920914082 1:210245187-210245209 CAGAGCACAGCAATGAGAGAAGG - Exonic
921772846 1:219062691-219062713 CTCAGCAAACCAAAAATTGAAGG + Intergenic
923122559 1:231006437-231006459 CTCAGCAAAGCTGACATAGAAGG + Intergenic
924551510 1:245082361-245082383 CTAAGCAAAGCATAATTAGAGGG + Intronic
1063982504 10:11466007-11466029 CTGGGCAAAGCAAATGTGGAAGG + Intronic
1064587322 10:16851996-16852018 GTGAGGGAGGCAAAGATAGAGGG - Intronic
1064587377 10:16852191-16852213 GTGAGGAAGGGAAAGATAGAGGG - Intronic
1064587423 10:16852363-16852385 GTGAGGGAGGCAAAGATAGAGGG - Intronic
1066135180 10:32438748-32438770 CAGCGCAAGGCAAAAATAGATGG - Intergenic
1066315917 10:34246385-34246407 CTGAGAAAAGGAAAAAAAGAAGG + Intronic
1068759141 10:60688597-60688619 ATGAGGAAAGCAAAGCAAGAGGG + Intronic
1069512981 10:69056116-69056138 CTGATCAAAGCAAAGATCTTCGG + Intergenic
1069577757 10:69543084-69543106 CTAGGCAAAGCAAAGAAATAGGG - Intergenic
1069984312 10:72273379-72273401 CTTTGCAAAGCAGGGATAGAGGG + Intergenic
1070027563 10:72646617-72646639 TGGTGCAAAGCAAAGATAAATGG - Intergenic
1070343722 10:75521877-75521899 CATAGCAAAGGAAAGCTAGAAGG + Intronic
1070727014 10:78799345-78799367 CAGAGGAAAGAAAAGGTAGAAGG - Intergenic
1070754638 10:78984439-78984461 TTGTACAAAGGAAAGATAGAGGG + Intergenic
1072090700 10:92124402-92124424 CTTTTAAAAGCAAAGATAGATGG + Intronic
1072508307 10:96092352-96092374 TTGAGTAAAGCAGAGAGAGAGGG + Intergenic
1075133358 10:119759881-119759903 CTGAGGGGAGCAAAGAGAGAAGG - Intronic
1075309353 10:121399378-121399400 CTGAGCAAACTAGAAATAGAGGG + Intergenic
1076045752 10:127293038-127293060 CTCAGCAAGGCAAAGAGAAAGGG + Intronic
1076130804 10:128012440-128012462 CTCAGCAAAGCAAGGGTAGCAGG - Intronic
1076201549 10:128562795-128562817 AAGAGCAAAGGAAAGAAAGAGGG + Intergenic
1076718946 10:132384417-132384439 TTGATCAAAACAAAGATGGAGGG - Intergenic
1079194158 11:18310246-18310268 CAGAGCAGAGCAAAGCCAGAAGG + Intronic
1079677512 11:23248787-23248809 CTGAGCAAAGAAAACAAAGCTGG - Intergenic
1079680535 11:23291238-23291260 CAGTCCAAAGGAAAGATAGAGGG - Intergenic
1082893109 11:58161517-58161539 CTGAGCAAAACAAAAACAAAAGG - Intronic
1083018136 11:59477707-59477729 CTGAGTGAAGCAATGATTGAAGG - Exonic
1084031330 11:66482369-66482391 CTGAGCAGAGCATAGATGTAGGG - Exonic
1084478548 11:69402750-69402772 CTGAGAGGAGCAAAGATAGCTGG + Intergenic
1084629800 11:70340514-70340536 CTGAACAGACCAAAGAAAGAAGG - Intronic
1086036494 11:82421667-82421689 CTGTGAAAAGGAAAGACAGAGGG + Intergenic
1086052537 11:82610423-82610445 CTGAGAATAGGAAAGATAAATGG - Intergenic
1086096517 11:83055327-83055349 CTGACCACAGCAAAGATGGCTGG + Intronic
1087251084 11:95901197-95901219 CTGAGAAGATTAAAGATAGAAGG - Intronic
1087375450 11:97334278-97334300 CTGAGCAGATCAAAGAAAGCAGG - Intergenic
1089094676 11:115909830-115909852 CTGTGCAAAGAAAGGATAGTTGG - Intergenic
1090104355 11:123836020-123836042 CATAACAAAGCAGAGATAGATGG - Intergenic
1092996247 12:13953634-13953656 CTGACCAAAGCAGAGAGAAAGGG - Intronic
1093966142 12:25328544-25328566 CTGAGCAAAACAAAGTTAACTGG - Intergenic
1095190578 12:39253307-39253329 CATAGAAAAACAAAGATAGAAGG - Intergenic
1096584050 12:52608077-52608099 CACAGCAAAGCAAAGCAAGAAGG + Exonic
1097247098 12:57612654-57612676 CTGAGCATAGCATAGATATGGGG - Intronic
1097804257 12:63947957-63947979 GTTAGCAAAGCAAGAATAGAAGG - Intronic
1098058102 12:66529915-66529937 CTGAATAAAGGAAAGAGAGAAGG + Intronic
1099871725 12:88358055-88358077 CTGAGTAAAGGAGAGAGAGAAGG - Intergenic
1100010637 12:89948732-89948754 CTGAGCAAAGCATAGGGAGACGG + Intergenic
1100178983 12:92063115-92063137 ATGAGCAACAAAAAGATAGATGG - Intronic
1100367006 12:93931180-93931202 CTGAGCACAGGCAAGTTAGATGG + Intergenic
1100676926 12:96878417-96878439 CTGCCCAAGGCAAGGATAGAAGG - Intergenic
1100973615 12:100098245-100098267 CAGAGAAAAGCAAAGTTAAAAGG + Intronic
1101644406 12:106616132-106616154 CTCAGAAAACCAAAGATAGAAGG - Intronic
1103860937 12:124013252-124013274 TTAAGCAAAGTATAGATAGAAGG - Exonic
1104172533 12:126296017-126296039 CGGAGGAAATCAAAGAAAGAAGG + Intergenic
1105040076 12:132955057-132955079 CTGGACAGAGCAAAGAAAGACGG + Intronic
1106382648 13:29255214-29255236 CTGAGCAGAGCAGAGACGGAAGG + Intronic
1107348068 13:39484523-39484545 GGGAGCAAAGGAAAGAGAGAGGG - Intronic
1107446162 13:40471957-40471979 CTGAGCAATTCAGGGATAGAAGG - Intergenic
1107873698 13:44770336-44770358 CTGAGCTAAGCCAAGTTGGATGG + Intergenic
1108551945 13:51555294-51555316 CTGGGCAAACCAATGATAGTGGG + Intergenic
1109123829 13:58491958-58491980 ATAAACAAAGCAAAGATAAATGG - Intergenic
1109399029 13:61800332-61800354 CTAAGGAAACTAAAGATAGAAGG + Intergenic
1111711590 13:91821608-91821630 CTTAGCAAACTAAAAATAGAGGG - Intronic
1112190614 13:97173801-97173823 ATTAGCCAGGCAAAGATAGAAGG - Intergenic
1113070405 13:106414666-106414688 GTGAGCAAAGCAGAGATCGGAGG - Intergenic
1115048831 14:29030616-29030638 CTGAGCAAAACAAACAAGGAGGG - Intergenic
1115521910 14:34241534-34241556 CTGAGTAAAGGAGAGATTGATGG - Intronic
1115812920 14:37130592-37130614 CTGACCTAAGCAAAAATAAATGG + Intronic
1115881445 14:37923592-37923614 CTCAGAACAGCAAAGATACAGGG - Intronic
1116105304 14:40495105-40495127 CTGAGCTAAGGATGGATAGATGG + Intergenic
1117017619 14:51534544-51534566 CTGGGCAAAGAAGAGAGAGACGG - Intronic
1117698116 14:58387089-58387111 CTCAACAAAGCAAGCATAGAAGG + Intergenic
1118821484 14:69349008-69349030 CTGACCCAAGCAAAGAAAAAGGG - Intronic
1119176290 14:72569756-72569778 CTGAGCTAAGCAAGGGAAGATGG - Intergenic
1119579163 14:75759839-75759861 CTCAGCAAATCAGAAATAGAAGG + Intronic
1119882136 14:78108113-78108135 CTCAGCAAACCAGGGATAGAAGG - Intergenic
1120394277 14:83948190-83948212 CTGAGCAAAACAAACAAAGCTGG - Intergenic
1120610073 14:86628706-86628728 GTGAACAAAGCAAAGACTGAGGG - Intergenic
1120738457 14:88081118-88081140 CTGAGCCATGCAAAGATGAAAGG - Intergenic
1121107280 14:91289284-91289306 CTCATCAAACCAAAGAAAGAGGG - Exonic
1122837703 14:104438153-104438175 CAAAGCAAAGGAAAGAAAGAGGG + Intergenic
1123138444 14:106052076-106052098 CTGAGTAAAGGAGAGATGGACGG - Intergenic
1124986812 15:34625747-34625769 CTTAGCAAACTAAAAATAGAGGG - Intergenic
1125865784 15:43047327-43047349 AAGAGCAGAGCAAAGAGAGAGGG - Intronic
1126401839 15:48279828-48279850 CTTAGCAAAATAAAGACAGATGG + Intronic
1127027523 15:54823896-54823918 TTGAGCAAAGAGAAGAAAGATGG - Intergenic
1127911886 15:63423070-63423092 CTGAGTGAAGCAAGCATAGAAGG - Intergenic
1129874242 15:78962237-78962259 CTGAGAAAAGAAAAGAGAAAAGG + Intronic
1130150964 15:81311262-81311284 CTGGGCAAAGCAAAGAAGTAGGG - Exonic
1130905318 15:88235911-88235933 CTCTGCAAGGCAAAGATACAAGG + Intronic
1131723041 15:95192075-95192097 CTGAGCCAGGCAAAAATTGAAGG + Intergenic
1131834043 15:96372591-96372613 CTGACCAAAACAAAGAAAGCTGG - Intergenic
1134001505 16:10786604-10786626 CAGAGCAAAGCAAACCAAGAAGG - Intronic
1134183782 16:12067353-12067375 GTAAGCCAAGCAAAGATGGAGGG + Intronic
1134543865 16:15092752-15092774 CTGAGCAAAGGAAGGATTGTTGG - Intronic
1136083771 16:27869995-27870017 CAGAGAAAAGGAAAGAGAGATGG - Intronic
1137308559 16:47230440-47230462 CTGAGAAAAGAAAAGAGAGATGG + Intronic
1139308362 16:66007151-66007173 CTGAGCAGAGCAGACTTAGAGGG - Intergenic
1140495966 16:75388713-75388735 CTGAACAAACCAAAGATTGCTGG + Intronic
1141195623 16:81858679-81858701 CTGATCAAAGGACAGATACAGGG + Intronic
1141336370 16:83158892-83158914 GTGAGTAAAGTAAAGAAAGAAGG - Intronic
1142516742 17:435803-435825 CTCAGCAAAGCAGGAATAGAAGG - Intergenic
1143159629 17:4860689-4860711 CTGAGCAGAGCAAAGAAGCAAGG + Intronic
1143764151 17:9126739-9126761 CGGAGTCAAGCACAGATAGAGGG + Intronic
1143927158 17:10381944-10381966 CTGACCAAGACAAGGATAGATGG + Intergenic
1146228368 17:31087557-31087579 CTGAGAAAAGTAAAGAAAGAGGG - Intergenic
1148594196 17:48839647-48839669 CAAAGCAAAGCAAAGAAAAAAGG - Intronic
1152234302 17:79130520-79130542 CTGAGCAAAGGAGAGAAAGAGGG - Intronic
1152308423 17:79534837-79534859 ATGTGCAAAACAAAGACAGAGGG + Intergenic
1154024805 18:10697094-10697116 CAGAGCAAAGCATAGATAAAAGG - Intronic
1154349345 18:13570118-13570140 CTAAGCAAAGCAAAGATAAAAGG + Intronic
1154465634 18:14641185-14641207 ATGGGGAAAGAAAAGATAGACGG - Intergenic
1155991814 18:32285945-32285967 CTGACCAAAGCACAGATTGTGGG - Intronic
1156042365 18:32836907-32836929 CTGAGCAAAGCAGCAGTAGATGG + Intergenic
1156055235 18:32994133-32994155 CTGAGGAAAGGAAAGATTCATGG - Intronic
1156876385 18:42018711-42018733 CAGAGAAAAGCAAACATTGAAGG - Intronic
1157204203 18:45684808-45684830 CTAAGCAAAGTAGAAATAGATGG + Intergenic
1158408068 18:57178043-57178065 GAGAGCAAAGCAGAGAGAGAAGG + Intergenic
1158595175 18:58809563-58809585 TTGGGTAAAGAAAAGATAGAAGG + Intergenic
1159319458 18:66828525-66828547 CTGAGCAAAAAGAAGATAGTTGG - Intergenic
1159736852 18:72110594-72110616 CTTAGTAAAGAAAAGATAGGAGG - Intergenic
1162239846 19:9341842-9341864 TTGTGTAAAGTAAAGATAGAGGG - Exonic
1163089077 19:15005983-15006005 ATGAACAAAGCAAAGGTAGATGG + Intronic
1165101360 19:33440436-33440458 CTGTCCAAAGCAGAGATGGAGGG - Intronic
1167698191 19:51027037-51027059 CTGAGAGACACAAAGATAGAAGG - Intronic
924997030 2:371175-371197 CTCAGCAAAGCAAGTTTAGAAGG - Intergenic
925224911 2:2175305-2175327 CTTAGAAAAGCAATGATAGCAGG - Intronic
925477040 2:4229001-4229023 CTCTACAAAGCACAGATAGAAGG - Intergenic
925818589 2:7777372-7777394 CTGGGCACAGCAAATATAAATGG + Intergenic
926159971 2:10481065-10481087 ATGAACAAACCAAAGAAAGAAGG - Intergenic
926487241 2:13477317-13477339 ATGAGGAAGGCAGAGATAGAAGG - Intergenic
926578707 2:14611216-14611238 GTTAGAAAAGCAAAGATCGATGG - Intergenic
929366498 2:41164099-41164121 CTGAGCAAAGTAAATATCTAGGG - Intergenic
929430455 2:41881999-41882021 CAGAGTAAAGGAAAGAGAGAAGG - Intergenic
931100104 2:58989196-58989218 CTTAGCAAAGTAAAGAGAAAGGG + Intergenic
931643228 2:64399602-64399624 CTGAGCATAGCATTGAAAGAAGG + Intergenic
933838779 2:86267967-86267989 CTTAGCAAAGTAGAAATAGAAGG + Intronic
935566223 2:104610385-104610407 CTGACAAAAACAAAGAGAGAAGG + Intergenic
937819479 2:126293003-126293025 CTCAGCAAAGTAAAAATAGAGGG + Intergenic
938691795 2:133798776-133798798 TTCAGCAAAGTAGAGATAGAGGG - Intergenic
939845350 2:147237889-147237911 CTCAGCAAATGAAAAATAGAAGG - Intergenic
940296175 2:152127194-152127216 CCCAGCAAAGCAAAGAAAGATGG - Intronic
940431106 2:153590786-153590808 CTCAGCAAACCAGATATAGAAGG + Intergenic
940913346 2:159228316-159228338 CTGAGCAAACCTAACACAGAAGG - Intronic
941712654 2:168730430-168730452 CTGAGTGAAGCAAAGAGAGAGGG + Intronic
943641215 2:190360196-190360218 CTGATCGAAGAAAAGAAAGAGGG + Exonic
945247430 2:207731659-207731681 CTGAGCAAAGCAATTATAGCTGG - Intronic
945880944 2:215324302-215324324 CTCAGCAAATTAAAAATAGAAGG - Intronic
946867121 2:224051765-224051787 CTGAGCAAAGGGAAAATAAAGGG + Intergenic
947694805 2:232176341-232176363 CTGACCAAAACAGAGAGAGAGGG - Intronic
1170483922 20:16795657-16795679 CTTAGCAAAGCACAGAGAAAGGG + Intergenic
1170932301 20:20780221-20780243 CTGAGTTGAGCAAGGATAGATGG - Intergenic
1173890736 20:46507700-46507722 CAGATCAAAGAAAAGAAAGACGG - Intronic
1174832628 20:53826800-53826822 CTGAGCAAAGCAGAAGGAGATGG + Intergenic
1175211283 20:57358017-57358039 CTGATCATAGAATAGATAGACGG + Intronic
1176690188 21:9897738-9897760 CTGAACACAGCAAAGATATCTGG - Intergenic
1176808923 21:13517297-13517319 ATGGGGAAAGAAAAGATAGACGG + Intergenic
1176989400 21:15477211-15477233 CTGAGAAAAGCAAATTTAAAGGG + Intergenic
1177478407 21:21653748-21653770 CTGATAAAAGCAAAGATCAATGG + Intergenic
1178374509 21:32055874-32055896 CTGAGAAAACCAAAGCTAGAGGG - Intergenic
1179471326 21:41612729-41612751 GTGAGCAAAGCAAGGATTGGAGG + Intergenic
1180152010 21:45953551-45953573 CTTAGCAAAGTAAGGACAGAGGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180706045 22:17810584-17810606 CAGAGCAGAGCAGAGGTAGACGG - Intronic
1181441947 22:22941343-22941365 CTGAGAATAGGAAAGATAGAGGG + Intergenic
1181749270 22:24977533-24977555 CTGAGCTAATCAGAGTTAGAGGG - Intronic
1183815887 22:40299825-40299847 AGGAGCAAACCAAAGATAGGAGG + Intronic
1184968157 22:47996338-47996360 GGAAGTAAAGCAAAGATAGATGG - Intergenic
1185066350 22:48633558-48633580 CAGAGCAAAGCATGGAGAGATGG - Intronic
949117808 3:349047-349069 CTGAGCGAAGGAAAAATAGCTGG - Intronic
949431924 3:3986145-3986167 CACAGAAAAGAAAAGATAGATGG - Intronic
949460332 3:4284816-4284838 ATGAGAAAAGCTAAGATAAAGGG + Intronic
949657566 3:6238376-6238398 CTGAGCCCAGCAAAGCTATAGGG + Intergenic
950317297 3:12014547-12014569 CTGAGCAGAGCAAAGGCAAATGG + Intronic
952714606 3:36467016-36467038 CTCAGCAAAGTAAGCATAGAAGG - Intronic
952730019 3:36628990-36629012 ATAAGCAAGGCAAAGATAGAAGG + Intergenic
953478080 3:43222895-43222917 CTGAGCAAAACACACATGGAGGG + Intergenic
954310629 3:49764031-49764053 CTCAACAAACTAAAGATAGAAGG + Intronic
954461733 3:50630664-50630686 CTGGGGAAAGCAAACAGAGAAGG - Intronic
955756469 3:62229641-62229663 CTGAGAAATCCAAAGAAAGATGG - Intronic
956004505 3:64763977-64763999 CAGACCATAGCAAAGGTAGAAGG - Intergenic
957214475 3:77301599-77301621 ATGAGCAAAGCAAAATTAAATGG + Intronic
957622621 3:82614068-82614090 AGGAGCAAAGGAAAGAAAGAGGG - Intergenic
957806083 3:85151055-85151077 GTGAGCAGAGCAATGGTAGATGG + Intronic
958713656 3:97750781-97750803 ATGTGTAAAGCAAAGCTAGAAGG + Intronic
958813790 3:98893631-98893653 CTGAAAAAAGCAGAGATACAAGG + Intronic
960434740 3:117611990-117612012 CTGAACAAAGAAAAGATATGAGG + Intergenic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
961854371 3:129854682-129854704 CTTGGCAAAGAAAGGATAGATGG - Intronic
962169754 3:133088364-133088386 CTGAGCAAAGCTAATACACAGGG + Intronic
962189148 3:133291810-133291832 CTGAGAAAGGCCGAGATAGATGG - Intronic
962560113 3:136597286-136597308 CTTAGTAAAGAAAAGAAAGAAGG + Intronic
964642379 3:158923580-158923602 CTTAGCAAAGTAGAAATAGAAGG - Intergenic
966948984 3:184798772-184798794 CTAAGCAAAGAAAAGAAAGAAGG - Intergenic
967299371 3:187997598-187997620 CTGGGCAAAGCAGACACAGAAGG - Intergenic
967666305 3:192176200-192176222 TTGAGCAAAGCACAGCTTGAGGG - Intronic
967738316 3:192977904-192977926 ATGAGCAAAACAAAAATAAATGG + Intergenic
968054396 3:195680468-195680490 TGGAGCAAAGCACAGTTAGAGGG + Intergenic
968101495 3:195968690-195968712 TGGAGCAAAGCACAGTTAGAGGG - Intergenic
969329944 4:6468712-6468734 CTAAGCAAAGGAAGGATGGATGG + Intronic
970268989 4:14322629-14322651 CTGACCACAGAAAAGATACATGG - Intergenic
970352680 4:15219047-15219069 CTCAGCAAAGTAGAAATAGAAGG + Intergenic
970612385 4:17737871-17737893 CTGAGGAACGCAAAGATACAAGG + Intronic
970834241 4:20382179-20382201 CTGAGCAAACTAGAAATAGAAGG + Intronic
971268728 4:25117422-25117444 CTGAGCAAGGCGCAGATATAAGG - Intergenic
972983432 4:44733675-44733697 CTCAGCAAACTAAAAATAGAAGG - Intergenic
974522833 4:63007548-63007570 CTGAGAAAAAAAAAAATAGATGG - Intergenic
975534883 4:75439366-75439388 CTCAGCAAAACACACATAGAGGG + Intergenic
978742891 4:112158480-112158502 CTGATCTAAGTCAAGATAGAAGG + Intronic
979393528 4:120157654-120157676 TTGAGCAAATAAAAAATAGAGGG + Intergenic
979928861 4:126604143-126604165 ATGAGAAAAGCAAACATTGAAGG - Intergenic
980353599 4:131715676-131715698 CTGAACACAGCAAAGATATCTGG - Intergenic
980835484 4:138186699-138186721 CTGAGCCAATCAAATATAAAAGG + Intronic
983346187 4:166527521-166527543 CTGAGGGAACCATAGATAGAAGG + Intergenic
983445677 4:167847647-167847669 CTGAGAAAAGCAAAAATATTGGG - Intergenic
983738403 4:171092780-171092802 CGGAGGAAAGCCAACATAGAAGG + Intergenic
984128042 4:175836705-175836727 TTGAGCAAAAAAAAAATAGAAGG + Intronic
984475729 4:180232024-180232046 CTGAGAAAATCAAAGGTAAATGG - Intergenic
985501464 5:250266-250288 TGGAGCAAAGCACAGTTAGAGGG + Intronic
985735418 5:1577368-1577390 TGGAGCAAAGCACAGTTAGAGGG - Intergenic
986130313 5:4923950-4923972 CTGAGTAAAGCAAATGTAGATGG + Intergenic
986446948 5:7829747-7829769 CAGAGCAAAGGAAAGATGAATGG - Exonic
986885975 5:12236976-12236998 CTGACCAAAGTAAAGAAATATGG + Intergenic
987109502 5:14672168-14672190 CTGAGCAAATCACAGATGTATGG + Intronic
987205259 5:15618929-15618951 CTTAGAAAAGGAAAGAAAGAAGG + Intronic
987665150 5:20927688-20927710 CTGAGCAAAAAGAAGAAAGATGG - Intergenic
988119642 5:26944051-26944073 ATGAGCAAAGCAAAAATAACAGG - Intronic
988757537 5:34274494-34274516 CTGAGCAAAAAGAAGAAAGATGG + Intergenic
990090144 5:52034857-52034879 CTCAGCAAATCAAAAAAAGAAGG + Intronic
992240157 5:74760665-74760687 CTGAGCAAAGGAAAGGTTGGTGG - Intronic
993140594 5:84028187-84028209 CTGAGTAAAGCAAGGAAAGTAGG - Intronic
993176614 5:84494557-84494579 CTGACCAAAGGAAGGATAAAGGG - Intergenic
993415447 5:87624327-87624349 CTGAGGAAAGAAAATATTGATGG - Intergenic
994865150 5:105259102-105259124 CTTAGTAGAGCAAAGATTGAAGG - Intergenic
995734288 5:115282346-115282368 CTGAGCAAAGCAAAGATAGATGG - Intronic
995781115 5:115776279-115776301 ATGAGCAAAGCAAAGACATATGG + Intergenic
995857957 5:116613739-116613761 ATAAGAAAAGCAAAGAAAGAGGG - Intergenic
996849648 5:127937920-127937942 CTGAGGAGAGAAAAGATGGAAGG + Intergenic
996926716 5:128835691-128835713 CAGAGCAAAGGCAAGAAAGAGGG - Intronic
997149192 5:131473908-131473930 CAGAGAAAAGCAAAGAGACATGG + Intronic
997880554 5:137585596-137585618 CTAAGCCAAGCAGAAATAGAGGG - Intronic
999058105 5:148603351-148603373 CTCAGCAAACTAAGGATAGAGGG + Intronic
999493321 5:152072830-152072852 CTGGGCAGAGCAGAGAGAGATGG + Intergenic
999508814 5:152226434-152226456 CTGAGCACAGTAAATATCGATGG + Intergenic
1000610702 5:163370898-163370920 CTGAGAAAACCCAAGATAAAAGG + Intergenic
1000692147 5:164337345-164337367 CTGATAAAAGCAAAAAGAGAGGG + Intergenic
1001012147 5:168108193-168108215 ATGAGCAAAGGAAGGAAAGAAGG + Intronic
1002363868 5:178695184-178695206 CTGAGTAGAGCAAAGAATGATGG - Intergenic
1002662494 5:180801328-180801350 TTAAGCAAAGCAGAGATAGAAGG - Intronic
1002939940 6:1707340-1707362 CTGAGCAATACATAGATAGATGG - Intronic
1003394050 6:5737773-5737795 ATCAGCAATGCACAGATAGACGG - Intronic
1007795513 6:44343608-44343630 CTGAGCAAAGGAAAGATGAAAGG - Intronic
1008045158 6:46844400-46844422 CTGTGGAAGGCAAAGAGAGATGG - Intergenic
1008549629 6:52615312-52615334 TTGAGCATGGCAATGATAGAAGG + Intergenic
1008789786 6:55216669-55216691 CTGAGCACAGCAAAGCCATAGGG - Intronic
1008948283 6:57124170-57124192 CTCAGCAAAGTAAGAATAGAAGG - Intronic
1009855815 6:69261780-69261802 CTGAGCAAAGGAAAGTTTTATGG + Intronic
1010648921 6:78427586-78427608 CTGAGGAATGCAAAGACAGCTGG + Intergenic
1010653180 6:78479361-78479383 CTCAGCAAAGCAATGATGGTTGG - Intergenic
1011184828 6:84662545-84662567 CAGAGCAAAGCAGTGAGAGAGGG + Intergenic
1012517177 6:100075869-100075891 ATGAGCAAAACATAGATGGATGG - Intergenic
1013976237 6:116081987-116082009 GAGAGCACAGCAAAGATAAATGG + Intergenic
1014494906 6:122109300-122109322 CTTAGTAAAGCAAAAATAGAAGG + Intergenic
1015155752 6:130094236-130094258 AAGAGCAAAGAAAAGAAAGAAGG - Intronic
1015966334 6:138698330-138698352 CTGAACAAAGGAGAGAGAGAAGG - Intergenic
1016621606 6:146116485-146116507 ATGAGTAAAGCACATATAGAAGG - Intronic
1016911960 6:149208079-149208101 CTGCCCAAGGCAGAGATAGAGGG - Intergenic
1017069468 6:150561334-150561356 TTAAGCAAAGCAGAAATAGAAGG + Intergenic
1017600420 6:156074482-156074504 CAGAGCACACCAAAAATAGAAGG - Intergenic
1018424395 6:163667419-163667441 CGGAGCAAAGCCAAGAGACAGGG + Intergenic
1019087671 6:169496267-169496289 CTCAACAAAGCAGAAATAGAAGG + Intronic
1019204553 6:170349124-170349146 AGGAGCAAAGCAGAGAAAGAGGG - Intronic
1019446752 7:1075187-1075209 CTGAGCAATGACAAGCTAGACGG + Intronic
1020390430 7:7651854-7651876 CTGAGCAGAAGAAAGAAAGAAGG - Intronic
1020394927 7:7703937-7703959 CTTAACAAAGGAAAGAAAGAAGG + Intronic
1020594880 7:10194085-10194107 ATTAGTAAAGCAAAGATTGATGG - Intergenic
1021131386 7:16916585-16916607 CTGAGCCAAGAAAAGGGAGAAGG + Intergenic
1021315559 7:19144268-19144290 CTGAGGAAAGGAAAAATGGAAGG - Intergenic
1021802379 7:24320093-24320115 CTAAACAAGGCAAAGAAAGAGGG + Intergenic
1021973263 7:25985352-25985374 CTGTGCAAAGAACAGAAAGAAGG - Intergenic
1024180388 7:46887276-46887298 CTGAGCAAAAGAAAGAAAAAAGG - Intergenic
1024810572 7:53206929-53206951 CATAGAAAAGTAAAGATAGAGGG + Intergenic
1025018918 7:55465320-55465342 TTGAGCCAATCAGAGATAGAAGG - Intronic
1026225328 7:68435229-68435251 CTGAGAAAATCAAAGATAAGGGG + Intergenic
1027830774 7:83174514-83174536 CTTAGCAAAGCAGAGTGAGAGGG - Intergenic
1028104591 7:86862105-86862127 CTGAGGAAAGGAAAGCTAAATGG + Intronic
1030839065 7:114325768-114325790 CTAAGTACATCAAAGATAGATGG - Intronic
1030898110 7:115086549-115086571 CTTTGCAAAGCAAATCTAGAAGG + Intergenic
1031129024 7:117809603-117809625 CTGAGTAAAAGAAAAATAGAAGG - Intronic
1032581246 7:133105361-133105383 CTGAGCTAGGAAAAGATAGATGG + Intergenic
1033591766 7:142814436-142814458 CAGAGCATGGCAAAGACAGAGGG - Intergenic
1035898526 8:3432286-3432308 CTATGCAAATGAAAGATAGACGG + Intronic
1036099656 8:5765198-5765220 CTGAGAAAGGCAAAGCTATAGGG + Intergenic
1036901760 8:12674713-12674735 ATCAGCAGAGTAAAGATAGAGGG + Intergenic
1037506538 8:19535799-19535821 CTCAGAAAAGCAAGAATAGAGGG + Intronic
1037916992 8:22778793-22778815 CTCAGCAGAGCAAGGAGAGAAGG - Intronic
1038623439 8:29167365-29167387 CTGACCAAAGCAGAGGTAGGAGG - Exonic
1038844467 8:31216056-31216078 TTGAGCAAAGCATACATACATGG + Intergenic
1039434835 8:37552951-37552973 CTTAGAAAAGCAAAGAAAGGGGG + Intergenic
1040828113 8:51645969-51645991 CTGAGAAGAGGAAAGACAGAGGG + Intronic
1040867414 8:52063061-52063083 CTTAGCAAACTAAAAATAGAAGG - Intergenic
1042528622 8:69792509-69792531 TTGAGCAAAGGAATGATATAAGG + Intronic
1043767913 8:84160858-84160880 CTGGAGAAAGCAAAAATAGAGGG - Intergenic
1044097950 8:88092311-88092333 ACGAGCAATGCAAAGATAAAAGG - Intronic
1044728063 8:95208871-95208893 GTGAGAAAAGGAAAGATGGAGGG - Intergenic
1045931185 8:107628464-107628486 CTTTGCAAAACAAAGACAGAGGG + Intergenic
1046795304 8:118365080-118365102 TTGAGAAAAGCAAACATATAAGG + Intronic
1047589110 8:126308518-126308540 ATGAGCATAGCATATATAGAGGG - Intergenic
1047638087 8:126788286-126788308 CTCAGCAAACTAAAAATAGAAGG - Intergenic
1047640079 8:126809617-126809639 AAGAGCAAAGCAAAGATATTAGG + Intergenic
1049829928 8:144693985-144694007 CTGAGCCAAGCAAATAGCGAGGG + Intergenic
1051043998 9:12851648-12851670 CTGAGGAAAGCAAGAAAAGAAGG + Intergenic
1051231685 9:14961838-14961860 CCCAGCAAAGCAAAGGAAGAAGG - Intergenic
1051563291 9:18467660-18467682 TTTAGCAAGGCAAGGATAGAAGG + Intergenic
1052960152 9:34288744-34288766 CTGAGGAATGCAAATATACAGGG + Intronic
1053626915 9:39882283-39882305 CTGAACACAGCAAAGATATCTGG - Intergenic
1053779075 9:41583737-41583759 CTGAACACAGCAAAGATATCTGG + Intergenic
1054167034 9:61793978-61794000 CTGAACACAGCAAAGATATCTGG + Intergenic
1054216971 9:62368420-62368442 CTGAACACAGCAAAGATATCTGG + Intergenic
1054670511 9:67786920-67786942 CTGAACACAGCAAAGATATCTGG - Intergenic
1055376412 9:75653374-75653396 CTGAGCAAAGAAATGAATGAAGG + Intergenic
1055664930 9:78543935-78543957 CTGAACACAGCAAAGATAGCTGG + Intergenic
1055928627 9:81536740-81536762 CTGAGCACTGCAAAAAGAGATGG + Intergenic
1056878496 9:90363627-90363649 CAGAGAAAAAGAAAGATAGAAGG - Intergenic
1057733920 9:97635233-97635255 CTGAGCATAACTAAGATGGAGGG + Intronic
1057815552 9:98291477-98291499 CTGGGCAAAGCAGAGGCAGACGG - Intronic
1058933206 9:109742948-109742970 CTGAGGGAAGCAGAGATAGAAGG + Intronic
1061464328 9:130765980-130766002 CTGAGGAAAGAAAAGATAAAGGG + Intronic
1185936215 X:4259336-4259358 CTGTGGAAAGCTAAGACAGAGGG - Intergenic
1186648124 X:11529068-11529090 CTGAGAAAAGTAAAAGTAGATGG - Intronic
1186941424 X:14512239-14512261 CTCAGCAAAACAAGCATAGAAGG + Intergenic
1186961568 X:14742420-14742442 CTCAGCAAACCAAAGACAGAGGG - Intergenic
1186985972 X:15014142-15014164 CTGAGCAAAACAAATAAAGTAGG + Intergenic
1187000242 X:15169275-15169297 CAGAGAAAGGCAAAGAAAGATGG - Intergenic
1187352006 X:18527766-18527788 CTTAGGAAAGAAAAGAAAGAAGG - Intronic
1188168859 X:26895928-26895950 CTAAGCAAGGAAAAGAGAGAGGG + Intergenic
1188332313 X:28890032-28890054 CTGAACAAAGCAAACAAAAAAGG - Intronic
1188555183 X:31403727-31403749 TTGAGAAATGCAAGGATAGATGG - Intronic
1189079799 X:37958990-37959012 CTGAGCACAGCAAAGCCACAGGG - Intronic
1189283901 X:39838520-39838542 CTGAGCAAATCAAGAATGGAGGG + Intergenic
1189596826 X:42575674-42575696 CTGAGCAAACTAGAAATAGAAGG - Intergenic
1189857569 X:45238581-45238603 CTGAGCAAAGCAGTGCTAAAAGG - Intergenic
1191600318 X:62997205-62997227 CTGAGTACAGTAAAGATAGCTGG - Intergenic
1191799243 X:65058966-65058988 CCAAGCAAAGCAATGACAGACGG - Intergenic
1194002341 X:88446054-88446076 CAGTGCATAGGAAAGATAGAAGG + Intergenic
1194568822 X:95527389-95527411 CAGAAAAAAACAAAGATAGAAGG + Intergenic
1195113092 X:101666875-101666897 GTGAGCCAAGCAAAGATGGAAGG + Intergenic
1196152963 X:112394063-112394085 CTGAGAATTGCAAAGATCGATGG + Intergenic
1197569243 X:128128662-128128684 CTCAGCAGAGCAGAGAGAGAAGG - Intergenic
1197942514 X:131804115-131804137 CTGAGCATAGCAAAGACAGCTGG + Intergenic
1198424193 X:136497932-136497954 CTCAGCAAAGCAAACGTAAAAGG - Intronic
1199108249 X:143898295-143898317 CTCAGCAAAGTAGAAATAGAAGG - Intergenic
1199357363 X:146877070-146877092 CTGAATAAAGCAAAGGTAAATGG - Intergenic
1199484631 X:148334428-148334450 CTGAGTAGAGCCAAGAGAGATGG - Intergenic
1200538764 Y:4432693-4432715 CTCAGCAAACCAAACATAAAAGG + Intergenic
1200749030 Y:6928406-6928428 CTGAGCAAAACTAAGGCAGAAGG - Intronic