ID: 995736173

View in Genome Browser
Species Human (GRCh38)
Location 5:115302182-115302204
Sequence CTGTGGAAAATGAGCAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995736173_995736179 18 Left 995736173 5:115302182-115302204 CCCTGCTTGCTCATTTTCCACAG No data
Right 995736179 5:115302223-115302245 CTACTTTGGGGAAAAAAGCTTGG No data
995736173_995736177 5 Left 995736173 5:115302182-115302204 CCCTGCTTGCTCATTTTCCACAG No data
Right 995736177 5:115302210-115302232 TTGAATCAATAGTCTACTTTGGG No data
995736173_995736176 4 Left 995736173 5:115302182-115302204 CCCTGCTTGCTCATTTTCCACAG No data
Right 995736176 5:115302209-115302231 TTTGAATCAATAGTCTACTTTGG No data
995736173_995736178 6 Left 995736173 5:115302182-115302204 CCCTGCTTGCTCATTTTCCACAG No data
Right 995736178 5:115302211-115302233 TGAATCAATAGTCTACTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995736173 Original CRISPR CTGTGGAAAATGAGCAAGCA GGG (reversed) Intergenic
No off target data available for this crispr