ID: 995736566

View in Genome Browser
Species Human (GRCh38)
Location 5:115307279-115307301
Sequence TGCAGGCAGTTGAGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995736566_995736570 -3 Left 995736566 5:115307279-115307301 CCTATTTCCCTCAACTGCCTGCA No data
Right 995736570 5:115307299-115307321 GCAAATAAATTTGAACATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995736566 Original CRISPR TGCAGGCAGTTGAGGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr