ID: 995736808

View in Genome Browser
Species Human (GRCh38)
Location 5:115310459-115310481
Sequence GAGAAGCAGGAAAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995736808_995736811 -7 Left 995736808 5:115310459-115310481 CCTGACCACTTTTCCTGCTTCTC No data
Right 995736811 5:115310475-115310497 GCTTCTCTCTCCATCTTTCCTGG No data
995736808_995736815 11 Left 995736808 5:115310459-115310481 CCTGACCACTTTTCCTGCTTCTC No data
Right 995736815 5:115310493-115310515 CCTGGTTCTCTAGCTACCCTGGG No data
995736808_995736813 10 Left 995736808 5:115310459-115310481 CCTGACCACTTTTCCTGCTTCTC No data
Right 995736813 5:115310492-115310514 TCCTGGTTCTCTAGCTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995736808 Original CRISPR GAGAAGCAGGAAAAGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr