ID: 995737318

View in Genome Browser
Species Human (GRCh38)
Location 5:115315563-115315585
Sequence TATTTGGTCCAGAACTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995737312_995737318 26 Left 995737312 5:115315514-115315536 CCTGTAGAAAAGCATTTTGTTGT No data
Right 995737318 5:115315563-115315585 TATTTGGTCCAGAACTTGGGTGG No data
995737313_995737318 3 Left 995737313 5:115315537-115315559 CCATCTATCTGACTCTGACTTCC No data
Right 995737318 5:115315563-115315585 TATTTGGTCCAGAACTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995737318 Original CRISPR TATTTGGTCCAGAACTTGGG TGG Intergenic
No off target data available for this crispr