ID: 995741536

View in Genome Browser
Species Human (GRCh38)
Location 5:115360757-115360779
Sequence AGTGCCCAAGCGATGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995741534_995741536 0 Left 995741534 5:115360734-115360756 CCTGGCGAATTTGCATTCCTAAA No data
Right 995741536 5:115360757-115360779 AGTGCCCAAGCGATGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995741536 Original CRISPR AGTGCCCAAGCGATGTTTTG AGG Intergenic
No off target data available for this crispr