ID: 995742151

View in Genome Browser
Species Human (GRCh38)
Location 5:115366245-115366267
Sequence TAGGCTACAGGCTCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995742151_995742160 27 Left 995742151 5:115366245-115366267 CCTCCCACAGAGCCTGTAGCCTA No data
Right 995742160 5:115366295-115366317 GGCAGCTAATAGCCTTGCCAAGG No data
995742151_995742158 5 Left 995742151 5:115366245-115366267 CCTCCCACAGAGCCTGTAGCCTA No data
Right 995742158 5:115366273-115366295 CAAGTGTCTGCTAAGCTATGAGG No data
995742151_995742159 6 Left 995742151 5:115366245-115366267 CCTCCCACAGAGCCTGTAGCCTA No data
Right 995742159 5:115366274-115366296 AAGTGTCTGCTAAGCTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995742151 Original CRISPR TAGGCTACAGGCTCTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr