ID: 995743456

View in Genome Browser
Species Human (GRCh38)
Location 5:115378664-115378686
Sequence ACAAAGCCAGCCCAGATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995743456_995743459 1 Left 995743456 5:115378664-115378686 CCCTGAATCTGGGCTGGCTTTGT No data
Right 995743459 5:115378688-115378710 ACTTGACCAATAGAATGTGGTGG No data
995743456_995743458 -2 Left 995743456 5:115378664-115378686 CCCTGAATCTGGGCTGGCTTTGT No data
Right 995743458 5:115378685-115378707 GTGACTTGACCAATAGAATGTGG No data
995743456_995743461 26 Left 995743456 5:115378664-115378686 CCCTGAATCTGGGCTGGCTTTGT No data
Right 995743461 5:115378713-115378735 ATAATATTGTGCTAGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995743456 Original CRISPR ACAAAGCCAGCCCAGATTCA GGG (reversed) Intergenic
No off target data available for this crispr