ID: 995743457

View in Genome Browser
Species Human (GRCh38)
Location 5:115378665-115378687
Sequence CACAAAGCCAGCCCAGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995743457_995743459 0 Left 995743457 5:115378665-115378687 CCTGAATCTGGGCTGGCTTTGTG No data
Right 995743459 5:115378688-115378710 ACTTGACCAATAGAATGTGGTGG No data
995743457_995743461 25 Left 995743457 5:115378665-115378687 CCTGAATCTGGGCTGGCTTTGTG No data
Right 995743461 5:115378713-115378735 ATAATATTGTGCTAGTTCCAAGG No data
995743457_995743458 -3 Left 995743457 5:115378665-115378687 CCTGAATCTGGGCTGGCTTTGTG No data
Right 995743458 5:115378685-115378707 GTGACTTGACCAATAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995743457 Original CRISPR CACAAAGCCAGCCCAGATTC AGG (reversed) Intergenic
No off target data available for this crispr